National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13879R-3 
 Symbol CG13879  Full Name CG13879 
 CG No CG13879  Old CG No CG13879 
 Synonyms CG13879 
 Accession No (Link to NCBI) NM_138176.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTAGGCCAGCACTTCGATGA 
 Primer Seq. 3'
aatctagaggtaccGCGAATCTACCTTCTCGATGA 
 Predicted Fragment Size
434 
 IR fragment full Seq
0001 TCTAGGCCAG CACTTCGATG ACCAGTTAAA GCTGGCTAGC GTGCGAGTTG GGCGATTTCT 
0061 CGGACGATGA CCTGGCGCTC CTTGACAAAT GCGCCCAATA TTATTCACTT TTGCACATTC 
0121 ACGACATCAA TCTGAACTAC TTGCGCGACT TCTATTGTGC CAAGAAGAGG GAATGCATAG 
0181 AAAACCGGCA GACCACAGTG CAGCAACGCG AAGANGCTGC AGCGCATCCT CTCGTCCATC 
0241 GAGGAGGCGA CTAGGGACGT AGTTATGTTG GAGAGATTTA ATGCTGCTGC GGAAGAGCGG 
0301 CTCATCCCGG ATATCGTCGT AATGCAGCGA AACGCCCAAC AGCTTGCAAC AAAACAGGCC 
0361 TTACTGGACC GGCAAAAAAC CCTTAAGATC CCAAAGGATT TTAGCATTGA AAGTGTCATC 
0421 GAGAAGGTAG ATTCNC 
 in silico PCR Fragment
0001 TCTAGGCCAG CACTTCGATG ACCAGTTAAA GCTGGCTAGC GT-CGAGTTG GGCGATTTCT 
0061 CGGACGATGA CCTGGCGCTC CTTGACAAAT GCGCCCAATA TTATTCACTT TTGCACATTC 
0121 ACGACATCAA TCTGAACTAC TTGCGCGACT TCTATTGTGC CAAGAAGAGG GAATGCATAG 
0181 AAAACCGGCA GACCACAGTG CAGCAACGCG TAGA-GCTGC AGCGCATCCT CTCGTCCATC 
0241 GAGGAGGCGA CTAGGGACGT AGTTATGTTG GAGAGATTTA ATGCTGCTGC GGAAGAGCGG 
0301 CTCATCCCGG ATATCGTCGT AATGCAGCGA AACGCCCAAC AGCTTGCAAC AAAACAGGCC 
0361 TTACTGGACC GGCAAAAAAC CCTTAAGATC CCAAAGGATT TTAGCATTGA AAGTGTCATC 
0421 GAGAAGGTAG ATTCGC 
 Assemble Data

13879R-3.IR_full       1   TCTAGGCCAGCACTTCGATGACCAGTTAAAGCTGGCTAGCGTGCGAGTTGGGCGATTTCT 60
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
13879R-3.in silico     1   TCTAGGCCAGCACTTCGATGACCAGTTAAAGCTGGCTAGCGT-CGAGTTGGGCGATTTCT 60


13879R-3.IR_full       61  CGGACGATGACCTGGCGCTCCTTGACAAATGCGCCCAATATTATTCACTTTTGCACATTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13879R-3.in silico     61  CGGACGATGACCTGGCGCTCCTTGACAAATGCGCCCAATATTATTCACTTTTGCACATTC 120


13879R-3.IR_full       121 ACGACATCAATCTGAACTACTTGCGCGACTTCTATTGTGCCAAGAAGAGGGAATGCATAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13879R-3.in silico     121 ACGACATCAATCTGAACTACTTGCGCGACTTCTATTGTGCCAAGAAGAGGGAATGCATAG 180


13879R-3.IR_full       181 AAAACCGGCAGACCACAGTGCAGCAACGCGAAGANGCTGCAGCGCATCCTCTCGTCCATC 240
                           |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||
13879R-3.in silico     181 AAAACCGGCAGACCACAGTGCAGCAACGCGTAGA-GCTGCAGCGCATCCTCTCGTCCATC 240


13879R-3.IR_full       241 GAGGAGGCGACTAGGGACGTAGTTATGTTGGAGAGATTTAATGCTGCTGCGGAAGAGCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13879R-3.in silico     241 GAGGAGGCGACTAGGGACGTAGTTATGTTGGAGAGATTTAATGCTGCTGCGGAAGAGCGG 300


13879R-3.IR_full       301 CTCATCCCGGATATCGTCGTAATGCAGCGAAACGCCCAACAGCTTGCAACAAAACAGGCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13879R-3.in silico     301 CTCATCCCGGATATCGTCGTAATGCAGCGAAACGCCCAACAGCTTGCAACAAAACAGGCC 360


13879R-3.IR_full       361 TTACTGGACCGGCAAAAAACCCTTAAGATCCCAAAGGATTTTAGCATTGAAAGTGTCATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13879R-3.in silico     361 TTACTGGACCGGCAAAAAACCCTTAAGATCCCAAAGGATTTTAGCATTGAAAGTGTCATC 420


13879R-3.IR_full       421 GAGAAGGTAGATTCNC 436
                           |||||||||||||| |
13879R-3.in silico     421 GAGAAGGTAGATTCGC 436

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   416  NM_138176.1  CG13879-RA (CG13879), mRNA 
0.48   NM_144094.1  CG15386-RA (CG15386), mRNA 
0.24   NM_143409.1  CG11873-RA (CG11873), mRNA 
0.24   NM_140936.2  CG17147-RA (CG17147), mRNA 
0   NM_142563.1  CG16718-RA, transcript variant A (CG16718), mRNA 
0   NM_169867.1  CG16718-RB, transcript variant B (CG16718), mRNA 
0   NM_132041.2  CG15765-RA (CG15765), mRNA 
0   NM_134508.2  CG32528-RA (CG32528), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_169656.1  CG6125-RA, transcript variant A (CG6125), mRNA 
0   NM_142208.2  CG6125-RB, transcript variant B (CG6125), mRNA 
0   NM_079191.2  CG14999-RA (RfC40), mRNA 
0   NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0   NM_135294.1  CG13795-RA (CG13795), mRNA 
0   NM_142307.1  CG12783-RA (CG12783), mRNA 
0   NM_135966.1  CG17928-RA (CG17928), mRNA 
0   NM_133061.2  CG32549-RD, transcript variant D (CG32549), mRNA 
0   NM_206785.1  CG32549-RF, transcript variant F (CG32549), mRNA 
0   NM_206787.1  CG32549-RA, transcript variant A (CG32549), mRNA 
0   NM_206786.1  CG32549-RB, transcript variant B (CG32549), mRNA 
0   NM_167614.1  CG32549-RE, transcript variant E (CG32549), mRNA 
0   NM_167615.1  CG32549-RC, transcript variant C (CG32549), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
DC
DM
VM
+- 
VB
 
Caspase-3 signal
N
 
DB
++ 
DC
++ 
DM
++  
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.