National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13849R-3 
 Symbol Nop56  Full Name Nop56 
 CG No CG13849  Old CG No CG13849 
 Synonyms FBgn0038964, CG13849, Nop56 
 Accession No (Link to NCBI) NM_142783.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wang H, Chen X, He T, Zhou Y, Luo H.
Evidence for tissue-specific Jak/STAT target genes in Drosophila optic lobe development.
Genetics (2013) 195(4) 1291-306 [ PubMed ID = 24077308 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTAAGCTGGCTGGATTTGCAC 
 Primer Seq. 3'
aatctagaggtaccGGCGAACATGTAATTGTCGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTAAGCTGGC TGGAttTGCA CCTTTCAAGA CGGCCATTGc CGCACTGGAA AACATCAATG 
0061 CCATATCCGA GGGCATAGTG CCGCAGGATC TGCTCTCCTT CTTGGATGAC TTCTTTGCCA 
0121 AGCTGAAGAA GAAGAAAGTG CACCCTGGGT ATTGCGGATG CCAAGCTGGG AGCTGCAATC 
0181 ACCGAGGCCA TTGGCGTCCA GTGCAGTCAC TTTGGAGTGG TTCCTGAGAT TNCTGCGCGG 
0241 CGTGCGATTN CCACTTCGCT AAGCTGGTCA AGGGATTCAC CGACAANGTC CGCTGGCGTT 
0301 GCTCAGCTGG GTCTGGGCCA CAGCTACTCG CGTGCCAAGG TCAAGTTCAA TGTTNCATCG 
0361 TTCCGACAAC ATGATCATCC AGTCGATTGC TTTGCTGGAT CAGTTGGATA AGGACGTAAA 
0421 TACCTTCTCT ATGCGGATAC GCGAGTGGTA CTCGTATCAC TTCCCAGAAC TGGTCAAAAT 
0481 CGTTCCCGAC AATTACATGT TCGNC 
 in silico PCR Fragment
0001 TTAAGCTGGC TGGATTTGCA CCTTTCAAGA CGGCCATTGC CGCACTGGAA AACATCAATG 
0061 CCATATCCGA GGGCATAGTG CCGCAGGATC TGCTCTCCTT CTTGGATGAC TTCTTTGCCA 
0121 AGCTGAAGAA GAAG-AAGTG CACCCTGGGT ATTGCGGATG CCAAGCTGGG AGCTGCAATC 
0181 ACCGAGGCCA TTGGCGTCCA GTGCAGTCAC TTTGGAGTGG TTCCTGAGAT T-CTGCGCGG 
0241 CGTGCGATT- CCACTTCGCT AAGCTGGTCA AGGGATTCAC CGACAA-GTC CGCTGGCGTT 
0301 GCTCAGCTGG GTCTGGGCCA CAGCTACTCG CGTGCCAAGG TCAAGTTCAA TGTT-CATCG 
0361 TTCCGACAAC ATGATCATCC AGTCGATTGC TTTGCTGGAT CAGTTGGATA AGGACGTAAA 
0421 TACCTTCTCT ATGCGGATAC GCGAGTGGTA CTCGTATCAC TTCCCAGAAC TGGTCAAAAT 
0481 CGTTCCCGAC AATTACATGT TCGCC 
 Assemble Data

13849R-3.IR_full       1   TTAAGCTGGCTGGATTTGCACCTTTCAAGACGGCCATTGCCGCACTGGAAAACATCAATG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13849R-3.in silico     1   TTAAGCTGGCTGGATTTGCACCTTTCAAGACGGCCATTGCCGCACTGGAAAACATCAATG 60


13849R-3.IR_full       61  CCATATCCGAGGGCATAGTGCCGCAGGATCTGCTCTCCTTCTTGGATGACTTCTTTGCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13849R-3.in silico     61  CCATATCCGAGGGCATAGTGCCGCAGGATCTGCTCTCCTTCTTGGATGACTTCTTTGCCA 120


13849R-3.IR_full       121 AGCTGAAGAAGAAGAAAGTGCACCCTGGGTATTGCGGATGCCAAGCTGGGAGCTGCAATC 180
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
13849R-3.in silico     121 AGCTGAAGAAGAAG-AAGTGCACCCTGGGTATTGCGGATGCCAAGCTGGGAGCTGCAATC 180


13849R-3.IR_full       181 ACCGAGGCCATTGGCGTCCAGTGCAGTCACTTTGGAGTGGTTCCTGAGATTNCTGCGCGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
13849R-3.in silico     181 ACCGAGGCCATTGGCGTCCAGTGCAGTCACTTTGGAGTGGTTCCTGAGATT-CTGCGCGG 240


13849R-3.IR_full       241 CGTGCGATTNCCACTTCGCTAAGCTGGTCAAGGGATTCACCGACAANGTCCGCTGGCGTT 300
                           ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||
13849R-3.in silico     241 CGTGCGATT-CCACTTCGCTAAGCTGGTCAAGGGATTCACCGACAA-GTCCGCTGGCGTT 300


13849R-3.IR_full       301 GCTCAGCTGGGTCTGGGCCACAGCTACTCGCGTGCCAAGGTCAAGTTCAATGTTNCATCG 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
13849R-3.in silico     301 GCTCAGCTGGGTCTGGGCCACAGCTACTCGCGTGCCAAGGTCAAGTTCAATGTT-CATCG 360


13849R-3.IR_full       361 TTCCGACAACATGATCATCCAGTCGATTGCTTTGCTGGATCAGTTGGATAAGGACGTAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13849R-3.in silico     361 TTCCGACAACATGATCATCCAGTCGATTGCTTTGCTGGATCAGTTGGATAAGGACGTAAA 420


13849R-3.IR_full       421 TACCTTCTCTATGCGGATACGCGAGTGGTACTCGTATCACTTCCCAGAACTGGTCAAAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13849R-3.in silico     421 TACCTTCTCTATGCGGATACGCGAGTGGTACTCGTATCACTTCCCAGAACTGGTCAAAAT 480


13849R-3.IR_full       481 CGTTCCCGACAATTACATGTTCGNC 505
                           ||||||||||||||||||||||| |
13849R-3.in silico     481 CGTTCCCGACAATTACATGTTCGCC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142783.2  CG13849-RA (Nop56), mRNA 
0   NM_166046.1  CG13849-RA (Nop56), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA 
0   NM_166045.1  CG13849-RA (Nop56), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA 
0   NM_143128.2  CG10562-RA (CG10562), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0   NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0   NM_136706.1  CG12920-RA (CG12920), mRNA 
0   NM_206786.1  CG32549-RB, transcript variant B (CG32549), mRNA 
0   NM_206787.1  CG32549-RA, transcript variant A (CG32549), mRNA 
0   NM_206785.1  CG32549-RF, transcript variant F (CG32549), mRNA 
0   NM_167615.1  CG32549-RC, transcript variant C (CG32549), mRNA 
0   NM_167614.1  CG32549-RE, transcript variant E (CG32549), mRNA 
0   NM_133061.2  CG32549-RD, transcript variant D (CG32549), mRNA 
0   NM_206059.1  CG8083-RC, transcript variant C (CG8083), mRNA 
0   NM_206060.1  CG8083-RB, transcript variant B (CG8083), mRNA 
0   NM_136602.3  CG8083-RA, transcript variant A (CG8083), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_137070.1  CG16935-RA (CG16935), mRNA 
0   NM_135793.2  CG16970-RA (CG16970), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_057939.3  CG4579-RA, transcript variant A (Nup154), mRNA 
0   NM_057940.3  CG4579-RB, transcript variant B (Nup154), mRNA 
0   NM_130652.2  CG8310-RA (CG8310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.