National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13831R-1 
 Symbol sav  Full Name salvador 
 CG No CG33193  Old CG No CG13831 
 Synonyms Salvador/Shar-pei, shar-pei, CG13831, CG33193, CG13832, anon-WO0172774.152, sav, Sav 
 Accession No (Link to NCBI) NM_176544.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ma M, Cao X, Dai J, Pastor-Pareja JC.
Basement Membrane Manipulation in Drosophila Wing Discs Affects Dpp Retention but Not Growth Mechanoregulation.
Dev. Cell (2017) 42(1) 97-106.e4 [ PubMed ID = 28697337 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGATCCTGCTGTGCAACCGA 
 Primer Seq. 3'
aatctagaggtaccCTACGCACATGCGGATGGGAG 
 Predicted Fragment Size
362 
 IR fragment full Seq
0001 ACGATNCCTG CTGTGCAACC GAAAACCGAC GATGCTCTCG CGCCGGAACA AGGAGAAGTC 
0061 CCAGCACAAG GAGGGCGTGG TGGGGAAGTA CATGAAGAAG GACACCCCAC CGGATATTTC 
0121 GGTGATCAAT GTGTGGAGCG ATCAGCGGGC CAAGAAGAAN ATCGCTGCAG cGCTGTGcGA 
0181 GCACNCTCGC CCAGCTGCGA GNTTCCATCC GCGCAGCTCG AGCACCAGTC GGAACACCTA 
0241 CTCCTGCACG GACTCGCAGC CGGACTACTA CCATGCTCGA CGAGCACAGA GCCAGATGCC 
0301 CCTGCAGCAG CACTCCCACT CGCATCCTCA CTCTCTGCCC CACCCCTCCC ATCCGCATGT 
0361 GCGTAG 
 in silico PCR Fragment
0001 ACGAT-CCTG CTGTGCAACC GAAAACCGAC GATGCTCTCG CGCCGGAACA AGGAGAAGTC 
0061 CCAGCACAAG GAGGGCGTGG TGGGGAAGTA CATGAAGAAG GACACCCCAC CGGATATTTC 
0121 GGTGATCAAT GTGTGGAGCG ATCAGCGGGC CAAGAAGAA- ATCGCTGCAG CGCTGTGCGA 
0181 GCAC-CTCGC CCAGCTGCGA G-TTCCATCC GCGCAGCTCG AGCACCAGTC GGAACACCTA 
0241 CTCCTGCACG GACTCGCAGC CGGACTACTA CCATGCTCGA CGAGCACAGA GCCAGATGCC 
0301 CCTGCAGCAG CACTCCCACT CGCATCCTCA CTCTCTGCCC CACCCCTCCC ATCCGCATGT 
0361 GCGTAG 
 Assemble Data

13831R-1.IR_full       1   ACGATNCCTGCTGTGCAACCGAAAACCGACGATGCTCTCGCGCCGGAACAAGGAGAAGTC 60
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
13831R-1.in silico     1   ACGAT-CCTGCTGTGCAACCGAAAACCGACGATGCTCTCGCGCCGGAACAAGGAGAAGTC 60


13831R-1.IR_full       61  CCAGCACAAGGAGGGCGTGGTGGGGAAGTACATGAAGAAGGACACCCCACCGGATATTTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13831R-1.in silico     61  CCAGCACAAGGAGGGCGTGGTGGGGAAGTACATGAAGAAGGACACCCCACCGGATATTTC 120


13831R-1.IR_full       121 GGTGATCAATGTGTGGAGCGATCAGCGGGCCAAGAAGAANATCGCTGCAGCGCTGTGCGA 180
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
13831R-1.in silico     121 GGTGATCAATGTGTGGAGCGATCAGCGGGCCAAGAAGAA-ATCGCTGCAGCGCTGTGCGA 180


13831R-1.IR_full       181 GCACNCTCGCCCAGCTGCGAGNTTCCATCCGCGCAGCTCGAGCACCAGTCGGAACACCTA 240
                           |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
13831R-1.in silico     181 GCAC-CTCGCCCAGCTGCGAG-TTCCATCCGCGCAGCTCGAGCACCAGTCGGAACACCTA 240


13831R-1.IR_full       241 CTCCTGCACGGACTCGCAGCCGGACTACTACCATGCTCGACGAGCACAGAGCCAGATGCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13831R-1.in silico     241 CTCCTGCACGGACTCGCAGCCGGACTACTACCATGCTCGACGAGCACAGAGCCAGATGCC 300


13831R-1.IR_full       301 CCTGCAGCAGCACTCCCACTCGCATCCTCACTCTCTGCCCCACCCCTCCCATCCGCATGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13831R-1.in silico     301 CCTGCAGCAGCACTCCCACTCGCATCCTCACTCTCTGCCCCACCCCTCCCATCCGCATGT 360


13831R-1.IR_full       361 GCGTAG 366
                           ||||||
13831R-1.in silico     361 GCGTAG 366

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   344  NM_176544.1  CG33193-RA (sav), mRNA 
0   NM_132608.2  CG32649-RA (CG32649), mRNA 
0   NM_134951.2  CG2808-RA, transcript variant A (CG2808), mRNA 
0   NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0   NM_137976.2  CG4091-RB, transcript variant B (CG4091), mRNA 
0   NM_170386.1  CG11876-RA, transcript variant A (CG11876), mRNA 
0   NM_170388.1  CG11876-RC, transcript variant C (CG11876), mRNA 
0   NM_143411.2  CG11876-RD, transcript variant D (CG11876), mRNA 
0   NM_170387.1  CG11876-RB, transcript variant B (CG11876), mRNA 
0   NM_132431.2  CG1655-RA (sofe), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_206673.1  CG32684-RF, transcript variant F (alpha-Man-I), mRNA 
0   NM_206672.1  CG32684-RG, transcript variant G (alpha-Man-I), mRNA 
0   NM_206676.1  CG32684-RC, transcript variant C (alpha-Man-I), mRNA 
0   NM_206674.1  CG32684-RE, transcript variant E (alpha-Man-I), mRNA 
0   NM_206675.1  CG32684-RD, transcript variant D (alpha-Man-I), mRNA 
0   NM_167223.1  CG32684-RA, transcript variant A (alpha-Man-I), mRNA 
0   NM_137718.2  CG9480-RA, transcript variant A (Glycogenin), mRNA 
0   NM_078550.2  CG32684-RB, transcript variant B (alpha-Man-I), mRNA 
0   NM_170639.1  CG17122-RA (CG17122), mRNA 
0   NM_136974.2  CG12373-RA (mRpL18), mRNA 
0   NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0   NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0   NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0   14  NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   14  NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_143534.2  CG15533-RA (CG15533), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.