National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1378R-2 
 Symbol tll  Full Name tailless 
 CG No CG1378  Old CG No CG1378 
 Synonyms NR2E2, Tll, CG1378, tll, TLL 
 Accession No (Link to NCBI) NM_079857.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTCCGGCAAGCATTACGGCA 
 Primer Seq. 3'
aatctagaggtaccGGGCGAGAAGAAACCGTGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTCCGGCAA GCATTACGGC ATCTACGCCT GTGATGGCTG GCGCCGGATT CTTCAAGAGG 
0061 AGCATTCGGA GATCCCGGCA GTATGTGTGC AAGTCGCAGA AGCAGGGACT CTGTGTGGTG 
0121 GACAAGACGC ACAGGAACCA ATGTAGGGCT TGCCGACTGA GGAAGTGCTT TGAGGTCGGA 
0181 ATGAACAAGG ATGCAGTGCA GCACGAGCGG GGACCGCGGA ACTCCACTCT GCGTCGCCAC 
0241 ATGGCCATGT ACAAGGATGC CATGATGGGC GCCGGCGAGA TGCCACAAAT ACCCGCCGAA 
0301 ATTCTGATGA ACACGGCTGC CTTGACCGGC TTTCCTGGAG TACCGATGCC CATGCCTGGC 
0361 CTGCCCCAGA GGGCTGGNTC ATCATCCTGC TCACATGGCT GCCTTCCAGC CGCCACCATC 
0421 GGCTGCCGCT GTCTTGGACT TATCCGTGCC ACGAGTGCCC CATCACCCGG TGCACCAAGG 
0481 ACACCACGGT TTCTTCTCGC CC 
 in silico PCR Fragment
0001 GCTCCGGCAA GCATTACGGC ATCTACGCCT GTGATGGCT- GCGCCGGATT CTTCAAGAGG 
0061 AGCATTCGGA GATCCCGGCA GTATGTGTGC AAGTCGCAGA AGCAGGGACT CTGTGTGGTG 
0121 GACAAGACGC ACAGGAACCA ATGTAGGGCT TGCCGACTGA GGAAGTGCTT TGAGGTCGGA 
0181 ATGAACAAGG ATGCAGTGCA GCACGAGCGG GGACCGCGGA ACTCCACTCT GCGTCGCCAC 
0241 ATGGCCATGT ACAAGGATGC CATGATGGGC GCCGGCGAGA TGCCACAAAT ACCCGCCGAA 
0301 ATTCTGATGA ACACGGCTGC CTTGACCGGC TTTCCTGGAG TACCGATGCC CATGCCTGGC 
0361 CTGCCCCAGA GGGCTGG-TC ATCATCCTGC TCACATGGCT GCCTTCCAGC CGCCACCATC 
0421 GGCTGCCGCT GTCTTGGACT TATCCGTGCC ACGAGTGCCC CATCACCCGG TGCACCAAGG 
0481 ACACCACGGT TTCTTCTCGC CC 
 Assemble Data

1378R-2.IR_full       1   GCTCCGGCAAGCATTACGGCATCTACGCCTGTGATGGCTGGCGCCGGATTCTTCAAGAGG 60
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
1378R-2.in silico     1   GCTCCGGCAAGCATTACGGCATCTACGCCTGTGATGGCT-GCGCCGGATTCTTCAAGAGG 60


1378R-2.IR_full       61  AGCATTCGGAGATCCCGGCAGTATGTGTGCAAGTCGCAGAAGCAGGGACTCTGTGTGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     61  AGCATTCGGAGATCCCGGCAGTATGTGTGCAAGTCGCAGAAGCAGGGACTCTGTGTGGTG 120


1378R-2.IR_full       121 GACAAGACGCACAGGAACCAATGTAGGGCTTGCCGACTGAGGAAGTGCTTTGAGGTCGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     121 GACAAGACGCACAGGAACCAATGTAGGGCTTGCCGACTGAGGAAGTGCTTTGAGGTCGGA 180


1378R-2.IR_full       181 ATGAACAAGGATGCAGTGCAGCACGAGCGGGGACCGCGGAACTCCACTCTGCGTCGCCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     181 ATGAACAAGGATGCAGTGCAGCACGAGCGGGGACCGCGGAACTCCACTCTGCGTCGCCAC 240


1378R-2.IR_full       241 ATGGCCATGTACAAGGATGCCATGATGGGCGCCGGCGAGATGCCACAAATACCCGCCGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     241 ATGGCCATGTACAAGGATGCCATGATGGGCGCCGGCGAGATGCCACAAATACCCGCCGAA 300


1378R-2.IR_full       301 ATTCTGATGAACACGGCTGCCTTGACCGGCTTTCCTGGAGTACCGATGCCCATGCCTGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     301 ATTCTGATGAACACGGCTGCCTTGACCGGCTTTCCTGGAGTACCGATGCCCATGCCTGGC 360


1378R-2.IR_full       361 CTGCCCCAGAGGGCTGGNTCATCATCCTGCTCACATGGCTGCCTTCCAGCCGCCACCATC 420
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     361 CTGCCCCAGAGGGCTGG-TCATCATCCTGCTCACATGGCTGCCTTCCAGCCGCCACCATC 420


1378R-2.IR_full       421 GGCTGCCGCTGTCTTGGACTTATCCGTGCCACGAGTGCCCCATCACCCGGTGCACCAAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1378R-2.in silico     421 GGCTGCCGCTGTCTTGGACTTATCCGTGCCACGAGTGCCCCATCACCCGGTGCACCAAGG 480


1378R-2.IR_full       481 ACACCACGGTTTCTTCTCGCCC 502
                          ||||||||||||||||||||||
1378R-2.in silico     481 ACACCACGGTTTCTTCTCGCCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079857.3  CG1378-RA (tll), mRNA 
0.41   NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0.41   NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0.2   NM_141071.1  CG7181-RA (CG7181), mRNA 
0.2   NM_132484.2  CG11750-RA (CG11750), mRNA 
0   11  10  46  NM_057792.2  CG9019-RA (dsf), mRNA 
0   10  21  NM_137188.1  CG16801-RB, transcript variant B (CG16801), mRNA 
0   21  NM_166092.1  CG16801-RA, transcript variant A (CG16801), mRNA 
0   NM_079281.3  CG12526-RA (Or67a), mRNA 
0   NM_140404.1  CG10743-RA, transcript variant A (CG10743), mRNA 
0   NM_168556.1  CG10743-RB, transcript variant B (CG10743), mRNA 
0   NM_141390.1  CG10296-RA (CG10296), mRNA 
0   13  NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   13  NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   13  NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_135066.1  CG14035-RA (CG14035), mRNA 
0   NM_135600.1  CG6750-RA (CG6750), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_140933.1  CG7017-RA (CG7017), mRNA 
0   NM_135908.2  CG18482-RA (CG18482), mRNA 
0   NM_079900.2  CG11144-RA (Glu-RA), mRNA 
0   16  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   12  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   17  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_164960.1  CG32830-RA (CG32830), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.