National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1378R-2 
 Symbol tll  Full Name tailless 
 CG No CG1378  Old CG No CG1378 
 Synonyms NR2E2, Tll, CG1378, tll, TLL 
 Accession No (Link to NCBI) NM_079857.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     1   GCTCCGGCAAGCATTACGGCATCTACGCCTGTGATGGCT-GCGCCGGATTCTTCAAGAGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCATTCGGAGATCCCGGCAGTATGTGTGCAAGTCGCAGAAGCAGGGACTCTGTGTGGTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACAAGACGCACAGGAACCAATGTAGGGCTTGCCGACTGAGGAAGTGCTTTGAGGTCGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGAACAAGGATGCAGTGCAGCACGAGCGGGGACCGCGGAACTCCACTCTGCGTCGCCAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATGGCCATGTACAAGGATGCCATGATGGGCGCCGGCGAGATGCCACAAATACCCGCCGAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTCTGATGAACACGGCTGCCTTGACCGGCTTTCCTGGAGTACCGATGCCCATGCCTGGC 360

                          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     361 CTGCCCCAGAGGGCTGG-TCATCATCCTGCTCACATGGCTGCCTTCCAGCCGCCACCATC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCTGCCGCTGTCTTGGACTTATCCGTGCCACGAGTGCCCCATCACCCGGTGCACCAAGG 480

1378R-2.IR_full       481 ACACCACGGTTTCTTCTCGCCC 502
                          |||||||||||||||||||||| silico     481 ACACCACGGTTTCTTCTCGCCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079857.3  CG1378-RA (tll), mRNA 
0.41   NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0.41   NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0.2   NM_141071.1  CG7181-RA (CG7181), mRNA 
0.2   NM_132484.2  CG11750-RA (CG11750), mRNA 
0   11  10  46  NM_057792.2  CG9019-RA (dsf), mRNA 
0   10  21  NM_137188.1  CG16801-RB, transcript variant B (CG16801), mRNA 
0   21  NM_166092.1  CG16801-RA, transcript variant A (CG16801), mRNA 
0   NM_079281.3  CG12526-RA (Or67a), mRNA 
0   NM_140404.1  CG10743-RA, transcript variant A (CG10743), mRNA 
0   NM_168556.1  CG10743-RB, transcript variant B (CG10743), mRNA 
0   NM_141390.1  CG10296-RA (CG10296), mRNA 
0   13  NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   13  NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   13  NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_135066.1  CG14035-RA (CG14035), mRNA 
0   NM_135600.1  CG6750-RA (CG6750), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_140933.1  CG7017-RA (CG7017), mRNA 
0   NM_135908.2  CG18482-RA (CG18482), mRNA 
0   NM_079900.2  CG11144-RA (Glu-RA), mRNA 
0   16  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   12  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   17  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_164960.1  CG32830-RA (CG32830), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.