National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13781R-1 
 Symbol Pvf3  Full Name PDGF- and VEGF-related factor 3 
 CG No CG34378  Old CG No CG13781 
 Synonyms CG13783, Pvf3, PDGF- and VEGF-related factor 3, CG31629, CG13781, CG13782, CG4492, DmVEGF-3, Vegf27Ca, VEGF27Ca, PVFs, VEGF, PVF, PVF3, CG34378 
 Accession No (Link to NCBI) NM_078776.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu Y, Brock AR, Wang Y, Fujitani K, Ueda R, Galko MJ.
A blood-borne PDGF/VEGF-like ligand initiates wound-induced epidermal cell migration in Drosophila larvae.
Curr. Biol. (2009) 19(17) 1473-7 [ PubMed ID = 19646875 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATACCCTGCGGCTTGCCTTG 
 Primer Seq. 3'
aatctagaggtaccATCTCGATTTGCTGCCACTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATACCCTGC GGCTTGCCTT GATTTTCCTA AGTTTTGTTC GCCTGGAGGC GCAGGCTAAT 
0061 GTTCAGAATA ATGGCTGGCA GAAGGTGTTG CCTGATGACT TCAGACGAGA ACGTGATAAA 
0121 AGTTCAACCA GAACGCGCCG GAATCCGCAG GAGGAATTGC GCCTGAGACA CGAGCAGCAT 
0181 CATTTGCGCC TGCAGCAACA TCAGATGGCG TGGGAGCTGG ACTTGCAGCG GCAGCTGCAG 
0241 TCAGCATCTG CAGGAGCAGC AGTCGGAGCA GTCGGAGCAG CAGAGCCGGC CGGTGCGTCA 
0301 TCATCAGCAT AAATCTCACA CCAAGGAGCT GGCCAAGAAG CCCATTAGAC GGGCACCAAG 
0361 TTTANGCGAT GACAAGGCCA AGATGGTGCA GAAGCGCAGA CTACACTACA ACGAGTACGA 
0421 TAACGAAGAT CTCGAGCTGC ACACCATCGA AACCGGCGAT CAGGGGACCT TCACCCCGCG 
0481 GCAGTGGCAG CAAATCGAGA T 
 in silico PCR Fragment
0001 AATACCCTGC GGCTTGCCTT GATTTTCCTA AGTTTTGTTC GCCTGGAGGC GCAGGCTAAT 
0061 GTTCAGAATA ATGGCTGGCA GAAGGTGTTG CCTGATGACT TCAGACGAGA ACGTGATAAA 
0121 AGTTCAACCA GAACGCGCCG GAATCCGCAG GAGGAATTGC GCCTGAGACA CGAGCAGCAT 
0181 CATTTGCGCC TGCAGCAACA TCAGATGGCG TGGGAGCTGG ACTTGCAGCG GCAGCTGCAG 
0241 -CAGCATCTG CAGGAGCAGC AGTCGGAGCA GTCGGAGCAG CAGAGCCGGC CGGTGCGTCA 
0301 TCATCAGCAT AAATCTCACA CCAAGGAACT GGCCAAGAAG CCCATTAGAC GGGCACCGAG 
0361 TTTCGGCGAT GACAAGGCCA AGATGGTGCA GAAGCGCAGA CTACACTACA ACGAGTACGA 
0421 TAACGAAGAT CTCGAGCTGC ACACCATCGA AACCGGCGAT CAGGGGACCT TCACCCCGCG 
0481 GCAGTGGCAG CAAATCGAGA T 
 Assemble Data

13781R-1.IR_full       1   AATACCCTGCGGCTTGCCTTGATTTTCCTAAGTTTTGTTCGCCTGGAGGCGCAGGCTAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     1   AATACCCTGCGGCTTGCCTTGATTTTCCTAAGTTTTGTTCGCCTGGAGGCGCAGGCTAAT 60


13781R-1.IR_full       61  GTTCAGAATAATGGCTGGCAGAAGGTGTTGCCTGATGACTTCAGACGAGAACGTGATAAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     61  GTTCAGAATAATGGCTGGCAGAAGGTGTTGCCTGATGACTTCAGACGAGAACGTGATAAA 120


13781R-1.IR_full       121 AGTTCAACCAGAACGCGCCGGAATCCGCAGGAGGAATTGCGCCTGAGACACGAGCAGCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     121 AGTTCAACCAGAACGCGCCGGAATCCGCAGGAGGAATTGCGCCTGAGACACGAGCAGCAT 180


13781R-1.IR_full       181 CATTTGCGCCTGCAGCAACATCAGATGGCGTGGGAGCTGGACTTGCAGCGGCAGCTGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     181 CATTTGCGCCTGCAGCAACATCAGATGGCGTGGGAGCTGGACTTGCAGCGGCAGCTGCAG 240


13781R-1.IR_full       241 TCAGCATCTGCAGGAGCAGCAGTCGGAGCAGTCGGAGCAGCAGAGCCGGCCGGTGCGTCA 300
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     241 -CAGCATCTGCAGGAGCAGCAGTCGGAGCAGTCGGAGCAGCAGAGCCGGCCGGTGCGTCA 300


13781R-1.IR_full       301 TCATCAGCATAAATCTCACACCAAGGAGCTGGCCAAGAAGCCCATTAGACGGGCACCAAG 360
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||
13781R-1.in silico     301 TCATCAGCATAAATCTCACACCAAGGAACTGGCCAAGAAGCCCATTAGACGGGCACCGAG 360


13781R-1.IR_full       361 TTTANGCGATGACAAGGCCAAGATGGTGCAGAAGCGCAGACTACACTACAACGAGTACGA 420
                           |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     361 TTTCGGCGATGACAAGGCCAAGATGGTGCAGAAGCGCAGACTACACTACAACGAGTACGA 420


13781R-1.IR_full       421 TAACGAAGATCTCGAGCTGCACACCATCGAAACCGGCGATCAGGGGACCTTCACCCCGCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13781R-1.in silico     421 TAACGAAGATCTCGAGCTGCACACCATCGAAACCGGCGATCAGGGGACCTTCACCCCGCG 480


13781R-1.IR_full       481 GCAGTGGCAGCAAATCGAGAT 501
                           |||||||||||||||||||||
13781R-1.in silico     481 GCAGTGGCAGCAAATCGAGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  20  NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
100   482  18  NM_135254.2  CG31629-RB, transcript variant B (Pvf3), mRNA 
1.45   28  98  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
1.03   16  15  NM_132311.2  CG12119-RA (CG12119), mRNA 
0.82   28  NM_141040.1  CG7752-RA (Z4), mRNA 
0.62   47  153  NM_132413.1  CG15295-RA (CG15295), mRNA 
0.62   21  NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0.62   21  NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0.62   21  NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0.62   21  NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0.62   21  NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0.62   21  NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0.62   21  NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0.62   21  NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0.62   21  NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0.62   21  NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0.62   21  NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0.41   63  NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0.41   63  NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0.41   63  NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0.41   15  81  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0.41   15  81  NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0.41   55  NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   18  32  266  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   18  32  248  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0   17  NM_167643.1  CG32537-RA (CG32537), mRNA 
0   16  100  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   16  55  NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   16  53  NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   16  53  NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.