National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13781R-1 
 Symbol Pvf3  Full Name PDGF- and VEGF-related factor 3 
 CG No CG34378  Old CG No CG13781 
 Synonyms CG13783, Pvf3, PDGF- and VEGF-related factor 3, CG31629, CG13781, CG13782, CG4492, DmVEGF-3, Vegf27Ca, VEGF27Ca, PVFs, VEGF, PVF, PVF3, CG34378 
 Accession No (Link to NCBI) NM_078776.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
[Please submit your publication]
Lopez-Bellido R, Puig S, Huang PJ, Tsai CR, Turner HN, Galko MJ, Gutstein HB.
Growth factor signaling regulates mechanical nociception in flies and vertebrates.
J. Neurosci. (2019) [ PubMed ID = 31138657 ] [ RRC reference ]

Wu Y, Brock AR, Wang Y, Fujitani K, Ueda R, Galko MJ.
A blood-borne PDGF/VEGF-like ligand initiates wound-induced epidermal cell migration in Drosophila larvae.
Curr. Biol. (2009) 19(17) 1473-7 [ PubMed ID = 19646875 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AATACCCTGCGGCTTGCCTTGATTTTCCTAAGTTTTGTTCGCCTGGAGGCGCAGGCTAAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTTCAGAATAATGGCTGGCAGAAGGTGTTGCCTGATGACTTCAGACGAGAACGTGATAAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGTTCAACCAGAACGCGCCGGAATCCGCAGGAGGAATTGCGCCTGAGACACGAGCAGCAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATTTGCGCCTGCAGCAACATCAGATGGCGTGGGAGCTGGACTTGCAGCGGCAGCTGCAG 240

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 -CAGCATCTGCAGGAGCAGCAGTCGGAGCAGTCGGAGCAGCAGAGCCGGCCGGTGCGTCA 300

                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || silico     301 TCATCAGCATAAATCTCACACCAAGGAACTGGCCAAGAAGCCCATTAGACGGGCACCGAG 360

                           |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTCGGCGATGACAAGGCCAAGATGGTGCAGAAGCGCAGACTACACTACAACGAGTACGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TAACGAAGATCTCGAGCTGCACACCATCGAAACCGGCGATCAGGGGACCTTCACCCCGCG 480

13781R-1.IR_full       481 GCAGTGGCAGCAAATCGAGAT 501
                           ||||||||||||||||||||| silico     481 GCAGTGGCAGCAAATCGAGAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  20  NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
100   482  18  NM_135254.2  CG31629-RB, transcript variant B (Pvf3), mRNA 
1.45   28  98  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
1.03   16  15  NM_132311.2  CG12119-RA (CG12119), mRNA 
0.82   28  NM_141040.1  CG7752-RA (Z4), mRNA 
0.62   47  153  NM_132413.1  CG15295-RA (CG15295), mRNA 
0.62   21  NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0.62   21  NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0.62   21  NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0.62   21  NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0.62   21  NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0.62   21  NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0.62   21  NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0.62   21  NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0.62   21  NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0.62   21  NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0.62   21  NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0.41   63  NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0.41   63  NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0.41   63  NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0.41   15  81  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 
0.41   15  81  NM_140090.1  CG16711-RA, transcript variant A (CG16711), mRNA 
0.41   55  NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   18  32  266  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   18  32  248  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0   17  NM_167643.1  CG32537-RA (CG32537), mRNA 
0   16  100  NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   16  55  NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   16  53  NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   16  53  NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.