National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13780R-2 
 Symbol Pvf2  Full Name PDGF- and VEGF-related factor 2 
 CG No CG13780  Old CG No CG13780 
 Synonyms PVF, VEGF-2, PVF2, VEGF, PVFs, pvf2, VEGF27Cb, Vegf27Cb, CG13780, DmVEGF-2, Pvf2, PV2 
 Accession No (Link to NCBI) NM_078775.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Song W, Kir S, Hong S, Hu Y, Wang X, Binari R, Tang HW, Chung V, Banks AS, Spiegelman B, Perrimon N.
Tumor-Derived Ligands Trigger Tumor Growth and Host Wasting via Differential MEK Activation.
Dev. Cell (2019) [ PubMed ID = 30639055 ] [ RRC reference ]

Wu Y, Brock AR, Wang Y, Fujitani K, Ueda R, Galko MJ.
A blood-borne PDGF/VEGF-like ligand initiates wound-induced epidermal cell migration in Drosophila larvae.
Curr. Biol. (2009) 19(17) 1473-7 [ PubMed ID = 19646875 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTTTCGAAGACGACACACGC 
 Primer Seq. 3'
aatctagaggtaccTGAGCTCCCTGGTACGATTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTTTCGAAG ACGACACACG CTTATTCCAG TTTTCCAACT GACATAAATA GCAATTACTT 
0061 CGACGTGCGG AATTCGACCT TGCCCATGAC CATGACCACC TCCCATCCAC AAACCAATCG 
0121 TCCTCTCGCT CGCTACGTTC TCCCCCCAAA CGAGTTGCAT ACCGCGGACG AGGACGAGGA 
0181 GTCCTCTGAC TTAGAGCCGT ACTTCGAGGA TCGAGCGGTC CAGCGGGACA GGTCGTATCT 
0241 CATCCGATTG ATCCGCCGGC GCGTGCCACG TGATCAGGCC CCCCAGCAAG TAATTCTTCA 
0301 GGGCCGCAGT CTCAGTGGCG TTCACTGGGG GCAGGGCGAC GACAATCATC TCAGCTCCGA 
0361 TGCGGCCGTC GATGGGAGCG ATGACTATCC ATCGGATCAG CCGGGCGATT TGACAGTGTT 
0421 GAAAGAGCGA ATCGCAGAAC AAAACTCCGT TGAAAAGTTG AGGACTATGA AATACAACAA 
0481 TAATCGTACC AGGGAGCTCA  
 in silico PCR Fragment
0001 ATTTTCGAAG ACGACACACG CTTATTCCAG TTTTCCAACT GACATAAATA GCAATTACTT 
0061 CGACGTGCGG AATTCGACCT TGCCCATGAC CATGACCACC TCCCATCCAC AAACCAATCG 
0121 TCCTCTCGCT CGCTACGTTC TCCCCCCAAA CGAGTTGCAT ACCGCGGACG AGGACGAAGA 
0181 GTCCTCTGAC TTAGAGCCGT ACTTTGAGGA TCGAGCGGTC CAGCGGGACA GGTCGTATCT 
0241 CATCCGATTG ATCCGCCGGC GCGTGCCACG TGATCAGGCC CCCCAGCAAG TAATTCTTCA 
0301 GGGCCGCAGT CTCAGTGGCG TTCACTGGGG GCAGGGCGAC GACAATCATC TCAGCTCCGA 
0361 TGCGGCCGTC GATGGGAGCG ATGACTATCC ATCGGATCAG CCGGGCGATT TGACAGTGTT 
0421 GAAAGAGCGA ATCGCCGAAC AAAACTCCGT TGAAAAGTTG AGGACTATGA AATACAACAA 
0481 TAATCGTACC AGGGAGCTCA  
 Assemble Data

13780R-2.IR_full       1   ATTTTCGAAGACGACACACGCTTATTCCAGTTTTCCAACTGACATAAATAGCAATTACTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     1   ATTTTCGAAGACGACACACGCTTATTCCAGTTTTCCAACTGACATAAATAGCAATTACTT 60


13780R-2.IR_full       61  CGACGTGCGGAATTCGACCTTGCCCATGACCATGACCACCTCCCATCCACAAACCAATCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     61  CGACGTGCGGAATTCGACCTTGCCCATGACCATGACCACCTCCCATCCACAAACCAATCG 120


13780R-2.IR_full       121 TCCTCTCGCTCGCTACGTTCTCCCCCCAAACGAGTTGCATACCGCGGACGAGGACGAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
13780R-2.in silico     121 TCCTCTCGCTCGCTACGTTCTCCCCCCAAACGAGTTGCATACCGCGGACGAGGACGAAGA 180


13780R-2.IR_full       181 GTCCTCTGACTTAGAGCCGTACTTCGAGGATCGAGCGGTCCAGCGGGACAGGTCGTATCT 240
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
13780R-2.in silico     181 GTCCTCTGACTTAGAGCCGTACTTTGAGGATCGAGCGGTCCAGCGGGACAGGTCGTATCT 240


13780R-2.IR_full       241 CATCCGATTGATCCGCCGGCGCGTGCCACGTGATCAGGCCCCCCAGCAAGTAATTCTTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     241 CATCCGATTGATCCGCCGGCGCGTGCCACGTGATCAGGCCCCCCAGCAAGTAATTCTTCA 300


13780R-2.IR_full       301 GGGCCGCAGTCTCAGTGGCGTTCACTGGGGGCAGGGCGACGACAATCATCTCAGCTCCGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     301 GGGCCGCAGTCTCAGTGGCGTTCACTGGGGGCAGGGCGACGACAATCATCTCAGCTCCGA 360


13780R-2.IR_full       361 TGCGGCCGTCGATGGGAGCGATGACTATCCATCGGATCAGCCGGGCGATTTGACAGTGTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     361 TGCGGCCGTCGATGGGAGCGATGACTATCCATCGGATCAGCCGGGCGATTTGACAGTGTT 420


13780R-2.IR_full       421 GAAAGAGCGAATCGCAGAACAAAACTCCGTTGAAAAGTTGAGGACTATGAAATACAACAA 480
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
13780R-2.in silico     421 GAAAGAGCGAATCGCCGAACAAAACTCCGTTGAAAAGTTGAGGACTATGAAATACAACAA 480


13780R-2.IR_full       481 TAATCGTACCAGGGAGCTCA 500
                           ||||||||||||||||||||
13780R-2.in silico     481 TAATCGTACCAGGGAGCTCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078775.2  CG13780-RA (Pvf2), mRNA 
0.2   NM_134562.2  CG1324-RA (CG1324), mRNA 
0   NM_143029.2  CG6892-RA, transcript variant A (Ets96B), mRNA 
0   NM_206567.1  CG6892-RB, transcript variant B (Ets96B), mRNA 
0   NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_133081.1  CG15047-RA (CG15047), mRNA 
0   NM_135019.1  CG15627-RA (CG15627), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_138206.1  CG3371-RA (CG3371), mRNA 
0   NM_168383.1  CG6718-RB, transcript variant B (CG6718), mRNA 
0   NM_168385.1  CG6718-RD, transcript variant D (CG6718), mRNA 
0   NM_140109.1  CG6718-RA, transcript variant A (CG6718), mRNA 
0   NM_168384.1  CG6718-RC, transcript variant C (CG6718), mRNA 
0   NM_137510.2  CG30122-RB (CG30122), mRNA 
0   NM_079456.2  CG6625-RA (Snap), mRNA 
0   NM_137370.3  CG14478-RB, transcript variant B (CG14478), mRNA 
0   NM_166229.2  CG14478-RA, transcript variant A (CG14478), mRNA 
0   NM_079938.3  CG2102-RA (cas), mRNA 
0   NM_170550.1  CG11337-RB, transcript variant B (CG11337), mRNA 
0   NM_057519.3  CG17998-RA (Gprk2), mRNA 
0   11  11  NM_133088.1  CG6632-RA (Ing3), mRNA 
0   11  NM_166895.1  CG11491-RD, transcript variant D (br), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_079317.2  CG10704-RA (toe), mRNA 
0   NM_165812.1  CG30029-RA (CG30029), mRNA 
0   NM_135869.1  CG3474-RA (CG3474), mRNA 
0   NM_132772.2  CG5599-RA (CG5599), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.