National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13780R-1 
 Symbol Pvf2  Full Name PDGF- and VEGF-related factor 2 
 CG No CG13780  Old CG No CG13780 
 Synonyms PVF, VEGF-2, PVF2, VEGF, PVFs, pvf2, VEGF27Cb, Vegf27Cb, CG13780, DmVEGF-2, Pvf2, PV2 
 Accession No (Link to NCBI) NM_078775.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Wu Y, Brock AR, Wang Y, Fujitani K, Ueda R, Galko MJ.
A blood-borne PDGF/VEGF-like ligand initiates wound-induced epidermal cell migration in Drosophila larvae.
Curr. Biol. (2009) 19(17) 1473-7 [ PubMed ID = 19646875 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATTTTCGAAGACGACACACGCTTATTCCAGTTTTCCAACTGACATAAATAGCAATTACTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGACGTGCGGAATTCGACCTTGCCCATGACCATGACCACCTCCCATCCACAAACCAATCG 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     121 TCCTCTCGCTCGCTACGTTCTCCCCCCAAACGAGTTGCATACCGCGGACGAGGACGAAGA 180

                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     181 GTCCTCTGACTTAGAGCCGTACTTTGAGGATCGAGCGGTCCAGCGGGACAGGTCGTATCT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCCGATTGATCCGCCGGCGCGTGCCACGTGATCAGGCCCCCCAGCAAGTAATTCTTCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGCCGCAGTCTCAGTGGCGTTCACTGGGGGCAGGGCGACGACAATCATCTCAGCTCCGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCGGCCGTCGATGGGAGCGATGACTATCCATCGGATCAGCCGGGCGATTTGACAGTGTT 420

                           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     421 GAAAGAGCGAATCGCCGAACAAAACTCCGTTGAAAAGTTGAGGACTATGAAATACAACAA 480

13780R-1.IR_full       481 TAATCGTACCAGGGAGCTCA 500
                           |||||||||||||||||||| silico     481 TAATCGTACCAGGGAGCTCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078775.2  CG13780-RA (Pvf2), mRNA 
0.2   NM_134562.2  CG1324-RA (CG1324), mRNA 
0   NM_143029.2  CG6892-RA, transcript variant A (Ets96B), mRNA 
0   NM_206567.1  CG6892-RB, transcript variant B (Ets96B), mRNA 
0   NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_133081.1  CG15047-RA (CG15047), mRNA 
0   NM_135019.1  CG15627-RA (CG15627), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_138206.1  CG3371-RA (CG3371), mRNA 
0   NM_168383.1  CG6718-RB, transcript variant B (CG6718), mRNA 
0   NM_168385.1  CG6718-RD, transcript variant D (CG6718), mRNA 
0   NM_140109.1  CG6718-RA, transcript variant A (CG6718), mRNA 
0   NM_168384.1  CG6718-RC, transcript variant C (CG6718), mRNA 
0   NM_137510.2  CG30122-RB (CG30122), mRNA 
0   NM_079456.2  CG6625-RA (Snap), mRNA 
0   NM_137370.3  CG14478-RB, transcript variant B (CG14478), mRNA 
0   NM_166229.2  CG14478-RA, transcript variant A (CG14478), mRNA 
0   NM_079938.3  CG2102-RA (cas), mRNA 
0   NM_170550.1  CG11337-RB, transcript variant B (CG11337), mRNA 
0   NM_057519.3  CG17998-RA (Gprk2), mRNA 
0   11  11  NM_133088.1  CG6632-RA (Ing3), mRNA 
0   11  NM_166895.1  CG11491-RD, transcript variant D (br), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_079317.2  CG10704-RA (toe), mRNA 
0   NM_165812.1  CG30029-RA (CG30029), mRNA 
0   NM_135869.1  CG3474-RA (CG3474), mRNA 
0   NM_132772.2  CG5599-RA (CG5599), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.