National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13746R-2 
 Symbol MrgBP  Full Name MrgBP 
 CG No CG13746  Old CG No CG13746 
 Synonyms dMrgB, dMrgBP, CG13746, MrgBP 
 Accession No (Link to NCBI) NM_136573.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||| ||||||||||||||||||    ||||||||||||||||||||||||||||||| silico     1   GCCAAG-GACAAGGGTCTGGCTGTG----GCCGGAACGGCGGCCCCCTTACCGGCCGCCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGACCACGAGTGGTCCGCCGAGGAAGAGCTGCAGCTGTTCCATGCAATGGAAGGCCTGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCCGGTGGGCATCAACAAGCACTTCTACATGTCCTGCATTGTCCAGCGTCTGTCCAAGT 180

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     181 CGCTGAACCGTGAAATGCCCAGCGAGCTGATCTGGCGCCACCTGGGCACCATGTACAAGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGAAGGAACTGGACGATCTGGAGTCGCTGCCCTTTCCCAACGAGGAGCGCGAGTTCAGCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCGGAGCAGGATTACGGAACGCTACAGACCAAAAAGACGGTGGAAGTGCATGCCAACG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGAGGCTGCAGAGGCACAGTCGGCCCCTCCAACAGCAGAGACCAATGGCAAAGCTCCAC 420

13746R-2.IR_full       421 CTGCAACCAAAACGCCGG 438
                           |||||||||||||||||| silico     421 CTGCAACCAAAACGCCGG 438

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   415  NM_136573.2  CG13746-RA (MrgBP), mRNA 
0.48   NM_167539.1  CG32571-RA (CG32571), mRNA 
0   NM_079750.3  CG5436-RA (Hsp68), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
0   NM_133156.1  CG12202-RA (Nat1), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_169632.1  CG6384-RB, transcript variant B (Cp190), mRNA 
0   NM_079635.2  CG6384-RA, transcript variant A (Cp190), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_140236.2  CG7334-RA, transcript variant A (Sug), mRNA 
0   NM_206335.1  CG7334-RB, transcript variant B (Sug), mRNA 
0   NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_080316.1  CG2655-RA (HLH3B), mRNA 
0   NM_135305.3  CG7149-RA (CG7149), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_143426.2  CG14508-RA (CG14508), mRNA 
0   NM_135017.2  CG15628-RA (CG15628), mRNA 
0   NM_132113.2  CG3184-RA (CG3184), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_143574.1  CG15546-RA (CG15546), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.