National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13746R-2 
 Symbol MrgBP  Full Name MrgBP 
 CG No CG13746  Old CG No CG13746 
 Synonyms dMrgB, dMrgBP, CG13746, MrgBP 
 Accession No (Link to NCBI) NM_136573.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCAAGGACAAGGGTCTGGCT 
 Primer Seq. 3'
aatctagaggtaccCCGGCGTTTTGGTTGCAGGTG 
 Predicted Fragment Size
433 
 IR fragment full Seq
0001 GCCAAGAGAC AAGGGTCTGG CTGTGAGNAG CCGGAAcgGC GGCCCCCTTA CCGGCCGCCC 
0061 TCGACCACGA GTGGTCCGCC GAGGAAGAGC TGCAGCTGTT CCATGCAATG GAAGGCCTGC 
0121 GCCCGGTGGG CATCAACAAG CACTTCTACA TGTCCTGCAT TGTCCAGCGT CTGTCCAAGT 
0181 CGCTGAACCG TGAAATGCCC AGTGAGCTGA TCTGGCGCCA CCTGGGCACC ATGTACAAGC 
0241 TGAAGGAACT GGACGATCTG GAGTCGCTGC CCTTTCCCAA CGAGGAGCGC GAGTTCAGCC 
0301 TGCCGGAGCA GGATTACGGA ACGCTACAGA CCAAAAAGAC GGTGGAAGTG CATGCCAACG 
0361 AGGAGGCTGC AGAGGCACAG TCGGCCCCTC CAACAGCAGA GACCAATGGC AAAGCTCCAC 
0421 CTGCAACCAA AACGCCGG 
 in silico PCR Fragment
0001 GCCAAG-GAC AAGGGTCTGG CTGTG----G CCGGAACGGC GGCCCCCTTA CCGGCCGCCC 
0061 TCGACCACGA GTGGTCCGCC GAGGAAGAGC TGCAGCTGTT CCATGCAATG GAAGGCCTGC 
0121 GCCCGGTGGG CATCAACAAG CACTTCTACA TGTCCTGCAT TGTCCAGCGT CTGTCCAAGT 
0181 CGCTGAACCG TGAAATGCCC AGCGAGCTGA TCTGGCGCCA CCTGGGCACC ATGTACAAGC 
0241 TGAAGGAACT GGACGATCTG GAGTCGCTGC CCTTTCCCAA CGAGGAGCGC GAGTTCAGCC 
0301 TGCCGGAGCA GGATTACGGA ACGCTACAGA CCAAAAAGAC GGTGGAAGTG CATGCCAACG 
0361 AGGAGGCTGC AGAGGCACAG TCGGCCCCTC CAACAGCAGA GACCAATGGC AAAGCTCCAC 
0421 CTGCAACCAA AACGCCGG 
 Assemble Data

13746R-2.IR_full       1   GCCAAGAGACAAGGGTCTGGCTGTGAGNAGCCGGAACGGCGGCCCCCTTACCGGCCGCCC 60
                           |||||| ||||||||||||||||||    |||||||||||||||||||||||||||||||
13746R-2.in silico     1   GCCAAG-GACAAGGGTCTGGCTGTG----GCCGGAACGGCGGCCCCCTTACCGGCCGCCC 60


13746R-2.IR_full       61  TCGACCACGAGTGGTCCGCCGAGGAAGAGCTGCAGCTGTTCCATGCAATGGAAGGCCTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13746R-2.in silico     61  TCGACCACGAGTGGTCCGCCGAGGAAGAGCTGCAGCTGTTCCATGCAATGGAAGGCCTGC 120


13746R-2.IR_full       121 GCCCGGTGGGCATCAACAAGCACTTCTACATGTCCTGCATTGTCCAGCGTCTGTCCAAGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13746R-2.in silico     121 GCCCGGTGGGCATCAACAAGCACTTCTACATGTCCTGCATTGTCCAGCGTCTGTCCAAGT 180


13746R-2.IR_full       181 CGCTGAACCGTGAAATGCCCAGTGAGCTGATCTGGCGCCACCTGGGCACCATGTACAAGC 240
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
13746R-2.in silico     181 CGCTGAACCGTGAAATGCCCAGCGAGCTGATCTGGCGCCACCTGGGCACCATGTACAAGC 240


13746R-2.IR_full       241 TGAAGGAACTGGACGATCTGGAGTCGCTGCCCTTTCCCAACGAGGAGCGCGAGTTCAGCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13746R-2.in silico     241 TGAAGGAACTGGACGATCTGGAGTCGCTGCCCTTTCCCAACGAGGAGCGCGAGTTCAGCC 300


13746R-2.IR_full       301 TGCCGGAGCAGGATTACGGAACGCTACAGACCAAAAAGACGGTGGAAGTGCATGCCAACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13746R-2.in silico     301 TGCCGGAGCAGGATTACGGAACGCTACAGACCAAAAAGACGGTGGAAGTGCATGCCAACG 360


13746R-2.IR_full       361 AGGAGGCTGCAGAGGCACAGTCGGCCCCTCCAACAGCAGAGACCAATGGCAAAGCTCCAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13746R-2.in silico     361 AGGAGGCTGCAGAGGCACAGTCGGCCCCTCCAACAGCAGAGACCAATGGCAAAGCTCCAC 420


13746R-2.IR_full       421 CTGCAACCAAAACGCCGG 438
                           ||||||||||||||||||
13746R-2.in silico     421 CTGCAACCAAAACGCCGG 438

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   415  NM_136573.2  CG13746-RA (MrgBP), mRNA 
0.48   NM_167539.1  CG32571-RA (CG32571), mRNA 
0   NM_079750.3  CG5436-RA (Hsp68), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
0   NM_133156.1  CG12202-RA (Nat1), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_169632.1  CG6384-RB, transcript variant B (Cp190), mRNA 
0   NM_079635.2  CG6384-RA, transcript variant A (Cp190), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   NM_140236.2  CG7334-RA, transcript variant A (Sug), mRNA 
0   NM_206335.1  CG7334-RB, transcript variant B (Sug), mRNA 
0   NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_080316.1  CG2655-RA (HLH3B), mRNA 
0   NM_135305.3  CG7149-RA (CG7149), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_143426.2  CG14508-RA (CG14508), mRNA 
0   NM_135017.2  CG15628-RA (CG15628), mRNA 
0   NM_132113.2  CG3184-RA (CG3184), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_143574.1  CG15546-RA (CG15546), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.