National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13704R-1 
 Symbol CG13704  Full Name CG13704 
 CG No CG13704  Old CG No CG13704 
 Synonyms BcDNA:RE40159, CG13704 
 Accession No (Link to NCBI) NM_139682.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Izumi Y, Furuse K, Furuse M.
The novel membrane protein Hoka regulates septate junction organization and stem cell homeostasis in the Drosophila gut.
J Cell Sci (2021) 134(6) [ PubMed ID = 33589496 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGCTCCACCTACTTGGTGA 
 Primer Seq. 3'
aatctagaggtaccGACAATAGCGGTGGCATGCGT 
 Predicted Fragment Size
392 
 IR fragment full Seq
0001 AGTGCTCCAC CTACTTGGTG ATATGCCTGG TACTGTTGGC CTGCTGCCTG CAAGAATCGG 
0061 AGGCCACGCG ACGTGTGAAC CGCGGACGAC GCACCCTTAC CCGCAGATAC TTCACTGGCC 
0121 TTGCTATTCC CGGATGGGCT CTCATCGTTT GTGTAGCGGT AGGTGAGCTG CTGATTGGTG 
0181 GAGCCCTCTA CTTCATCCTC AAGAAGGTGA TCCTGGACAA GGAACCAGAT CANGACGGCG 
0241 GCCTCCTACA CGCCCGCCCA GACTCATGCG ACGGCCACAC CTTATACTCC CGCCCAGACT 
0301 CACGATCCGG CCACGGCCAC AACCTATACT CCTGCTCAGA CTCATGAGAC GGCCAATGTG 
0361 ACTCCCACTC CAACGCATGC CACCGCTATT GTC 
 in silico PCR Fragment
0001 AGTGCTCCAC CTACTTGGTG ATATGCCTGG TACTGTTGGC CTGCTGCCTG CAAGAATCGG 
0061 AGGCCACGCG ACGTGTGAAC CGCGGACGAC GCACCCTTAC CCGCAGATAC TTCACTGGCC 
0121 TTGCTATTCC CGGATGGGCT CTCATCGTTT GTGTAGCGGT AGGTGAGCTG CTGATTGGTG 
0181 GAGCCCTCTA CTTCATCCTC AAGAAGGTGA TCCTGGACAA GGAACCAGAT CA-GACGGCG 
0241 GCCTCCTACA CGCCCGCCCA GACTCATGCG ACGGCCACAC CTTATACTCC CGCCCAGACT 
0301 CACGATCCGG CCACGGCCAC AACCTATACT CCTGCCCAGA CTCATGAGAC GGCCAATGTG 
0361 ACTCCCACTC CAACGCATGC CACCGCTATT GTC 
 Assemble Data

13704R-1.IR_full       1   AGTGCTCCACCTACTTGGTGATATGCCTGGTACTGTTGGCCTGCTGCCTGCAAGAATCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13704R-1.in silico     1   AGTGCTCCACCTACTTGGTGATATGCCTGGTACTGTTGGCCTGCTGCCTGCAAGAATCGG 60


13704R-1.IR_full       61  AGGCCACGCGACGTGTGAACCGCGGACGACGCACCCTTACCCGCAGATACTTCACTGGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13704R-1.in silico     61  AGGCCACGCGACGTGTGAACCGCGGACGACGCACCCTTACCCGCAGATACTTCACTGGCC 120


13704R-1.IR_full       121 TTGCTATTCCCGGATGGGCTCTCATCGTTTGTGTAGCGGTAGGTGAGCTGCTGATTGGTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13704R-1.in silico     121 TTGCTATTCCCGGATGGGCTCTCATCGTTTGTGTAGCGGTAGGTGAGCTGCTGATTGGTG 180


13704R-1.IR_full       181 GAGCCCTCTACTTCATCCTCAAGAAGGTGATCCTGGACAAGGAACCAGATCANGACGGCG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
13704R-1.in silico     181 GAGCCCTCTACTTCATCCTCAAGAAGGTGATCCTGGACAAGGAACCAGATCA-GACGGCG 240


13704R-1.IR_full       241 GCCTCCTACACGCCCGCCCAGACTCATGCGACGGCCACACCTTATACTCCCGCCCAGACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13704R-1.in silico     241 GCCTCCTACACGCCCGCCCAGACTCATGCGACGGCCACACCTTATACTCCCGCCCAGACT 300


13704R-1.IR_full       301 CACGATCCGGCCACGGCCACAACCTATACTCCTGCTCAGACTCATGAGACGGCCAATGTG 360
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
13704R-1.in silico     301 CACGATCCGGCCACGGCCACAACCTATACTCCTGCCCAGACTCATGAGACGGCCAATGTG 360


13704R-1.IR_full       361 ACTCCCACTCCAACGCATGCCACCGCTATTGTC 393
                           |||||||||||||||||||||||||||||||||
13704R-1.in silico     361 ACTCCCACTCCAACGCATGCCACCGCTATTGTC 393

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   374  12  30  56  NM_139682.1  CG13704-RA (CG13704), mRNA 
0   NM_135203.2  CG11043-RA (CG11043), mRNA 
0   NM_206442.1  CG1030-RC, transcript variant C (Scr), mRNA 
0   NM_206443.1  CG1030-RB, transcript variant B (Scr), mRNA 
0   NM_079524.3  CG1030-RA, transcript variant A (Scr), mRNA 
0   NM_139776.2  CG10289-RA (CG10289), mRNA 
0   NM_169955.2  CG10823-RB, transcript variant B (SIFR), mRNA 
0   NM_142709.2  CG10823-RA, transcript variant A (SIFR), mRNA 
0   NM_080104.2  CG4032-RA (Abl), mRNA 
0   NM_139929.3  CG7387-RA (CG7387), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_170030.1  CG5248-RD, transcript variant D (loco), mRNA 
0   NM_057825.3  CG2928-RA (Reg-5), mRNA 
0   NM_166696.1  CG9071-RB, transcript variant B (NaCP60E), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
0   NM_176384.2  CG10508-RC, transcript variant C (CG10508), mRNA 
0   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_165635.1  CG8251-RB, transcript variant B (Pgi), mRNA 
0   NM_165636.1  CG8251-RC, transcript variant C (Pgi), mRNA 
0   NM_078939.2  CG8251-RA, transcript variant A (Pgi), mRNA 
0   NM_141907.2  CG10014-RA (CG10014), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.