National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13478R-2 
 Symbol shd  Full Name shade 
 CG No CG13478  Old CG No CG13478 
 Synonyms Cyp314a1, 314a1, CG13478, shd 
 Accession No (Link to NCBI) NM_140452.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Akagi K, Sarhan M, Sultan AR, Nishida H, Koie A, Nakayama T, Ueda H.
A biological timer in the fat body comprising Blimp-1, ╬▓Ftz-f1 and Shade regulates pupation timing in Drosophila melanogaster.
Development (2016) 143(13) 2410-6 [ PubMed ID = 27226323 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCTCCAATGTGCCAATAGT 
 Primer Seq. 3'
aatctagaggtaccATTTCCACAGACCTAGACCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCCTCCAAT GTGCCAATAG TGCACCTGTA CAATCGCGAT GATCTGGAGA AGGTGCTGAA 
0061 GTACCCCAGC AAATACCCAT TCCGACCTCC CACTGAGATC ATCGTGATGT ACCGTCAATC 
0121 CCGACCGGAT CGCTATGCAA GTGTTNGGAA TTGTGAACGA GCAAGGACCA ATGTGGCAGC 
0181 GCCTAACGAT NCTTCCCTGA CCTCCAGCAT TACTTCTCCC AGGGTCCTGC AGAATTTCCT 
0241 GCCAGCCTTG AATGCGGTTT GTGATGATTT TATCGAACTA CTGCGAGCCA GGCGGGATCC 
0301 GGATACACTG GTgGTTCCCA ATTTCGAAGA GCTGGCCAAT CTGATGGGTC TGGAAGCTGT 
0361 GTGCACTTTA ATGTTGGGCA GAAGGATGGG TTTCCTGGCT ATCGATACCA AgNAGCCGCA 
0421 AAAGATCAgN CAACTGGCAG CTGCTGTTAA ACAGCTTTTC ATCTcCCAAA GGGACTCGTA 
0481 CTACGGTCTA GGTCTGTGGA AAT 
 in silico PCR Fragment
0001 GCCCTCCAAT GTGCCAATAG TGCACCTGTA CAATCGCGAT GATCTGGAGA AGGTGCTGAA 
0061 GTACCCCAGC AAATACCCAT TCCGACCTCC CACTGAGATC ATCGTGATGT ACCGTCAATC 
0121 CCGACCGGAT CGCTATGCAA GTGTT-GGAA TTGTGAACGA GCAAGGACCA ATGTGGCAGC 
0181 GCCT-ACGAT -CTTCCCTGA CCTCCAGCAT TACTTCTCCC AGGGTCCTGC AGAATTTCCT 
0241 GCCAGCCTTG AATGCGGTTT GTGATGATTT TATCGAACTA CTGCGAGCCA GGCGGGATCC 
0301 GGATACACTG GTGGTTCCCA ATTTCGAAGA GCTGGCCAAT CTGATGGGTC TGGAAGCTGT 
0361 GTGCACTTTA ATGTTGGGCA GAAGGATGGG TTTCCTGGCT ATCGATACCA AGCAGCCGCA 
0421 AAAGATCAGC CAACTGGCAG CTGCTGTTAA ACAGCTTTTC ATCTCCCAAA GGGACTCGTA 
0481 CTACGGTCTA GGTCTGTGGA AAT 
 Assemble Data

13478R-2.IR_full       1   GCCCTCCAATGTGCCAATAGTGCACCTGTACAATCGCGATGATCTGGAGAAGGTGCTGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     1   GCCCTCCAATGTGCCAATAGTGCACCTGTACAATCGCGATGATCTGGAGAAGGTGCTGAA 60


13478R-2.IR_full       61  GTACCCCAGCAAATACCCATTCCGACCTCCCACTGAGATCATCGTGATGTACCGTCAATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     61  GTACCCCAGCAAATACCCATTCCGACCTCCCACTGAGATCATCGTGATGTACCGTCAATC 120


13478R-2.IR_full       121 CCGACCGGATCGCTATGCAAGTGTTNGGAATTGTGAACGAGCAAGGACCAATGTGGCAGC 180
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
13478R-2.in silico     121 CCGACCGGATCGCTATGCAAGTGTT-GGAATTGTGAACGAGCAAGGACCAATGTGGCAGC 180


13478R-2.IR_full       181 GCCTAACGATNCTTCCCTGACCTCCAGCATTACTTCTCCCAGGGTCCTGCAGAATTTCCT 240
                           |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     181 GCCT-ACGAT-CTTCCCTGACCTCCAGCATTACTTCTCCCAGGGTCCTGCAGAATTTCCT 240


13478R-2.IR_full       241 GCCAGCCTTGAATGCGGTTTGTGATGATTTTATCGAACTACTGCGAGCCAGGCGGGATCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     241 GCCAGCCTTGAATGCGGTTTGTGATGATTTTATCGAACTACTGCGAGCCAGGCGGGATCC 300


13478R-2.IR_full       301 GGATACACTGGTGGTTCCCAATTTCGAAGAGCTGGCCAATCTGATGGGTCTGGAAGCTGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     301 GGATACACTGGTGGTTCCCAATTTCGAAGAGCTGGCCAATCTGATGGGTCTGGAAGCTGT 360


13478R-2.IR_full       361 GTGCACTTTAATGTTGGGCAGAAGGATGGGTTTCCTGGCTATCGATACCAAGNAGCCGCA 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
13478R-2.in silico     361 GTGCACTTTAATGTTGGGCAGAAGGATGGGTTTCCTGGCTATCGATACCAAGCAGCCGCA 420


13478R-2.IR_full       421 AAAGATCAGNCAACTGGCAGCTGCTGTTAAACAGCTTTTCATCTCCCAAAGGGACTCGTA 480
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13478R-2.in silico     421 AAAGATCAGCCAACTGGCAGCTGCTGTTAAACAGCTTTTCATCTCCCAAAGGGACTCGTA 480


13478R-2.IR_full       481 CTACGGTCTAGGTCTGTGGAAAT 503
                           |||||||||||||||||||||||
13478R-2.in silico     481 CTACGGTCTAGGTCTGTGGAAAT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206352.1  CG13478-RB, transcript variant B (shd), mRNA 
100   482  NM_140452.2  CG13478-RA, transcript variant A (shd), mRNA 
0   NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_142583.2  CG4703-RA (Arc42), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_139556.1  CG12012-RA (CG12012), mRNA 
0   NM_079591.4  CG6684-RA, transcript variant A (RpS25), mRNA 
0   NM_169376.1  CG6684-RB, transcript variant B (RpS25), mRNA 
0   NM_133083.1  CG15040-RA (CG15040), mRNA 
0   NM_001031933.1  CG33232-RD, transcript variant D (CG33232), mRNA 
0   NM_206245.1  CG33232-RB, transcript variant B (CG33232), mRNA 
0   NM_206246.1  CG33232-RA, transcript variant A (CG33232), mRNA 
0   NM_165964.1  CG30487-RA (CG30487), mRNA 
0   NM_206244.1  CG33232-RC, transcript variant C (CG33232), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_079135.2  CG2727-RA, transcript variant A (emp), mRNA 
0   NM_166703.1  CG2727-RC, transcript variant C (emp), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.