National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13478R-1 
 Symbol shd  Full Name shade 
 CG No CG13478  Old CG No CG13478 
 Synonyms Cyp314a1, 314a1, CG13478, shd 
 Accession No (Link to NCBI) NM_140452.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Akagi K, Sarhan M, Sultan AR, Nishida H, Koie A, Nakayama T, Ueda H.
A biological timer in the fat body comprising Blimp-1, ╬▓Ftz-f1 and Shade regulates pupation timing in Drosophila melanogaster.
Development (2016) 143(13) 2410-6 [ PubMed ID = 27226323 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCCTCCAATGTGCCAATAGTGCACCTGTACAATCGCGATGATCTGGAGAAGGTGCTGAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTACCCCAGCAAATACCCATTCCGACCTCCCACTGAGATCATCGTGATGTACCGTCAATC 120

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     121 CCGACCGGATCGCTATGCAAGTGTT-GGAATTGTGAACGAGCAAGGACCAATGTGGCAGC 180

                           |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCT-ACGAT-CTTCCCTGACCTCCAGCATTACTTCTCCCAGGGTCCTGCAGAATTTCCT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCAGCCTTGAATGCGGTTTGTGATGATTTTATCGAACTACTGCGAGCCAGGCGGGATCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGATACACTGGTGGTTCCCAATTTCGAAGAGCTGGCCAATCTGATGGGTCTGGAAGCTGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     361 GTGCACTTTAATGTTGGGCAGAAGGATGGGTTTCCTGGCTATCGATACCAAGCAGCCGCA 420

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAGATCAGCCAACTGGCAGCTGCTGTTAAACAGCTTTTCATCTCCCAAAGGGACTCGTA 480

13478R-1.IR_full       481 CTACGGTCTAGGTCTGTGGAAAT 503
                           ||||||||||||||||||||||| silico     481 CTACGGTCTAGGTCTGTGGAAAT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206352.1  CG13478-RB, transcript variant B (shd), mRNA 
100   482  NM_140452.2  CG13478-RA, transcript variant A (shd), mRNA 
0   NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_142583.2  CG4703-RA (Arc42), mRNA 
0   NM_134281.1  CG8651-RC, transcript variant C (trx), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_001014621.1  CG8651-RE, transcript variant E (trx), mRNA 
0   NM_057422.2  CG8651-RB, transcript variant B (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_139556.1  CG12012-RA (CG12012), mRNA 
0   NM_079591.4  CG6684-RA, transcript variant A (RpS25), mRNA 
0   NM_169376.1  CG6684-RB, transcript variant B (RpS25), mRNA 
0   NM_133083.1  CG15040-RA (CG15040), mRNA 
0   NM_001031933.1  CG33232-RD, transcript variant D (CG33232), mRNA 
0   NM_206245.1  CG33232-RB, transcript variant B (CG33232), mRNA 
0   NM_206246.1  CG33232-RA, transcript variant A (CG33232), mRNA 
0   NM_165964.1  CG30487-RA (CG30487), mRNA 
0   NM_206244.1  CG33232-RC, transcript variant C (CG33232), mRNA 
0   NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   NM_079135.2  CG2727-RA, transcript variant A (emp), mRNA 
0   NM_166703.1  CG2727-RC, transcript variant C (emp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.