National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13431R-1 
 Symbol Mgat1  Full Name UDP-GlcNAc:a-3-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase I 
 CG No CG13431  Old CG No CG13431 
 Synonyms dMGAT1, GlcNAc-TI, CG13431, MGAT1, Mgat1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGAACGCGCAAGGTGCTA 
 Primer Seq. 3'
aatctagaggtaccAGGATTGCCTCCTTGGTGGGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

13431R-1.IR full       1   GATGCGAACG-GCAAGGTGCTATTGGTAATTGGCTTTCTGGTTACGTGGACCTATGCCAC 60
                            ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     1   -ATGCGAACGCGCAAGGTGCTATTGGTAATTGGCTTTCTGGTTACGTGGACCTATGCCAC 60


13431R-1.IR full       61  CTACTACCTGCTGTTGCGCCAAACGGGCATCCATACGAGCCGGCATCAGTCGCTTCAGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     61  CTACTACCTGCTGTTGCGCCAAACGGGCATCCATACGAGCCGGCATCAGTCGCTTCAGGC 120


13431R-1.IR full       121 CTACAAGCTCAACTCGCAGGCTCGCGATGCCAATATGCAAAGCCATCATCTGGCCAAGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     121 CTACAAGCTCAACTCGCAGGCTCGCGATGCCAATATGCAAAGCCATCATCTGGCCAAGAA 180


13431R-1.IR full       181 CGTGTTTGAGTTCGTCAAGCTGAAGTACTTGGAGAAGCAACCACCGTCGGTGGCATCCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     181 CGTGTTTGAGTTCGTCAAGCTGAAGTACTTGGAGAAGCAACCACCGTCGGTGGCATCCAC 240


13431R-1.IR full       241 GCCGCAAATTAGCATAATTGCCGCCGAAATATCGGCGGAGCTGCCGGAGCAGCATGTGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     241 GCCGCAAATTAGCATAATTGCCGCCGAAATATCGGCGGAGCTGCCGGAGCAGCATGTGGC 300


13431R-1.IR full       301 CAAGTCGGCAACGGCGCGCATTCCAACGAAAACATATCTGGCCAATGGCGAGCCCGTTTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
13431R-1.in silico     301 CAAGTCGGCAACGGCGCGCATTCCAACGAAAACATATCTGGCCAATGGCGAGCCCGTGTT 360


13431R-1.IR full       361 TCCAGTCGTGGTCTTCGCCTGCAATCGGGTGTCGGTGAAGAAGTGCATCGATAACTTGGT 420
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     361 TCCAGTCGTAGTCTTCGCCTGCAATCGGGTGTCGGTGAAGAAGTGCATCGATAACTTGGT 420


13431R-1.IR full       421 TCAGTACAGGCCCAGCGTGGAGCAGTTCCCCATTATTGTGTCACAGGACTGCGGCGATGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13431R-1.in silico     421 TCAGTACAGGCCCAGCGTGGAGCAGTTCCCCATTATTGTGTCACAGGACTGCGGCGATGA 480


13431R-1.IR full       481 GCCCACCAAGGAGGCAATCCT 501
                           |||||||||||||||||||||
13431R-1.in silico     481 GCCCACCAAGGAGGCAATCCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_080378.2  UDP-GlcNAc:a-3-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase I CG13431-RA (Mgat1), mRNA 
0.41  NM_132176.2  CG12151-RA (CG12151), mRNA 
NM_135169.2  Pez CG9493-RA (Pez), mRNA 
NM_132885.2  CG3679-RA (CG3679), mRNA 
NM_001043133.1  furry CG32045-RD, transcript variant D (fry), mRNA 
NM_168357.2  furry CG32045-RB, transcript variant B (fry), mRNA 
NM_140331.2  CG10627-RA (CG10627), mRNA 
NM_132888.1  CG13957-RA (CG13957), mRNA 
NM_079467.2  fringe CG10580-RA (fng), mRNA 
NM_135239.1  CG18304-RA (CG18304), mRNA 
NM_079821.2  Protein C kinase 98E CG1954-RA (Pkc98E), mRNA 
NM_139942.3  CG7207-RA (CG7207), mRNA 
NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
NM_057873.4  congested-like trachea CG3057-RA, transcript variant A (colt), mRNA 
NM_205896.1  congested-like trachea CG3057-RB, transcript variant B (colt), mRNA 
NM_205895.1  congested-like trachea CG3057-RC, transcript variant C (colt), mRNA 
NM_205894.1  congested-like trachea CG3057-RD, transcript variant D (colt), mRNA 
NM_166924.1  CG4199-RF, transcript variant F (CG4199), mRNA 
NM_166921.1  CG4199-RE, transcript variant E (CG4199), mRNA 
NM_139505.3  Sphingosine kinase 2 CG32484-RA (Sk2), mRNA 
NM_166923.1  CG4199-RC, transcript variant C (CG4199), mRNA 
NM_130620.2  CG4199-RD, transcript variant D (CG4199), mRNA 
NM_166922.1  CG4199-RB, transcript variant B (CG4199), mRNA 
NM_166925.1  CG4199-RA, transcript variant A (CG4199), mRNA 
12  NM_078604.3  highwire CG32592-RA (hiw), mRNA 
NM_166044.1  CG8547-RB, transcript variant B (CG8547), mRNA 
NM_137103.2  CG8547-RA, transcript variant A (CG8547), mRNA 
NM_057310.3  nanos CG5637-RA (nos), mRNA 
NM_164989.1  rab3-GAP CG7061-RB, transcript variant B (rab3-GAP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.