National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13348R-4 
 Symbol Aats-phe  Full Name Phenylalanyl-tRNA synthetase 
 CG No CG13348  Old CG No CG13348 
 Synonyms unnamed, PheRS, FRS, Pts, CG13348, Aats-phe 
 Accession No (Link to NCBI) NM_057935.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCACGGCACTGGTTGAAG 
 Primer Seq. 3'
aatctagaggtaccACCGGATAGTGGGTGCTATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCACGGC ACTGGTTGAA GTCCACCCGC TGCCTGGCCA GCANGTGCgG CGCCCGCGAA 
0061 GTCGCCGTCA TCGCCACCGC AGCTGGAGGT CAGTGGAAGC ACGTACGCCA CCGACGGATG 
0121 GACGAACGTA ACGCCCAAGA TACTCTCCTA CGTGGGGGCC AACAANGCAC CTGCAGACGG 
0181 ACCACCCGCT GTCCATCATC CGCCAGAGGA TCGTCAACTA CTTTTATGGA GCGTATCNCA 
0241 ACCAAAGGGG CAATCCACTA TTCTCCGTCT ATGATCAAAT GAATCCGGTG GTTACTGTGC 
0301 AGCAGAACTT TGACAATCTG CTAATTCCCG CCGATCATGT GAGTCGACAG AAATCCGATT 
0361 GCTATTACAT CAATCAGCAG CATCTGCTGC GCGCCCACAC CACCGCCCAT CAGGTGGAAT 
0421 TGATCTCGGG CGGGCTAGAC AACTTTCTGG TCGTGGGCGA GGTGTATCGA CGGGACGAAA 
0481 TCGATAGCAC CCACTATCCG GT 
 in silico PCR Fragment
0001 GGAGCACGGC ACTGGTTGAA GTCCACCCGC TGCCTGGCCA GCA-GTGCGG CGCCCGCGAA 
0061 GTCGCCGTCA TCGCCACCGC AGCTGGAGGT CAGTGGAAGC ACGTACGCCA CCGACGGATG 
0121 GACGAACGTA ACGCCCAAGA TACTCTCCTA CGTGGGGGCC AACAA-GCAC CTGCAGACGG 
0181 ACCACCCGCT TTCCATCATC CGCCAGAGGA TCGTAAACTA CTTTTATGGA GCGTATCGCA 
0241 ACCAAAGGGG CAATCCACTA TTCTCCGTCT ATGATCAAAT GAATCCGGTG GTTACTGTGC 
0301 AGCAGAACTT TGACAATCTG CTAATTCCCG CCGATCATGT GAGTCGACAG AAATCCGATT 
0361 GCTATTACAT CAATCAGCAG CATCTGCTGC GCGCCCACAC CACCGCCCAT CAGGTGGAAT 
0421 TGATCTCGGG CGGGCTGGAC AACTTTCTGG TCGTGGGCGA GGTGTATCGA CGGGACGAAA 
0481 TCGATAGCAC CCACTATCCG GT 
 Assemble Data

13348R-4.IR_full       1   GGAGCACGGCACTGGTTGAAGTCCACCCGCTGCCTGGCCAGCANGTGCGGCGCCCGCGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
13348R-4.in silico     1   GGAGCACGGCACTGGTTGAAGTCCACCCGCTGCCTGGCCAGCA-GTGCGGCGCCCGCGAA 60


13348R-4.IR_full       61  GTCGCCGTCATCGCCACCGCAGCTGGAGGTCAGTGGAAGCACGTACGCCACCGACGGATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13348R-4.in silico     61  GTCGCCGTCATCGCCACCGCAGCTGGAGGTCAGTGGAAGCACGTACGCCACCGACGGATG 120


13348R-4.IR_full       121 GACGAACGTAACGCCCAAGATACTCTCCTACGTGGGGGCCAACAANGCACCTGCAGACGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
13348R-4.in silico     121 GACGAACGTAACGCCCAAGATACTCTCCTACGTGGGGGCCAACAA-GCACCTGCAGACGG 180


13348R-4.IR_full       181 ACCACCCGCTGTCCATCATCCGCCAGAGGATCGTCAACTACTTTTATGGAGCGTATCNCA 240
                           |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||
13348R-4.in silico     181 ACCACCCGCTTTCCATCATCCGCCAGAGGATCGTAAACTACTTTTATGGAGCGTATCGCA 240


13348R-4.IR_full       241 ACCAAAGGGGCAATCCACTATTCTCCGTCTATGATCAAATGAATCCGGTGGTTACTGTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13348R-4.in silico     241 ACCAAAGGGGCAATCCACTATTCTCCGTCTATGATCAAATGAATCCGGTGGTTACTGTGC 300


13348R-4.IR_full       301 AGCAGAACTTTGACAATCTGCTAATTCCCGCCGATCATGTGAGTCGACAGAAATCCGATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13348R-4.in silico     301 AGCAGAACTTTGACAATCTGCTAATTCCCGCCGATCATGTGAGTCGACAGAAATCCGATT 360


13348R-4.IR_full       361 GCTATTACATCAATCAGCAGCATCTGCTGCGCGCCCACACCACCGCCCATCAGGTGGAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13348R-4.in silico     361 GCTATTACATCAATCAGCAGCATCTGCTGCGCGCCCACACCACCGCCCATCAGGTGGAAT 420


13348R-4.IR_full       421 TGATCTCGGGCGGGCTAGACAACTTTCTGGTCGTGGGCGAGGTGTATCGACGGGACGAAA 480
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
13348R-4.in silico     421 TGATCTCGGGCGGGCTGGACAACTTTCTGGTCGTGGGCGAGGTGTATCGACGGGACGAAA 480


13348R-4.IR_full       481 TCGATAGCACCCACTATCCGGT 502
                           ||||||||||||||||||||||
13348R-4.in silico     481 TCGATAGCACCCACTATCCGGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057935.4  CG13348-RA (Aats-phe), mRNA 
0   NM_057976.2  CG1897-RA (Dr), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_130730.1  CG2941-RA (CG2941), mRNA 
0   NM_167309.1  CG32663-RA (CG32663), mRNA 
0   NM_132635.1  CG4187-RA (CG4187), mRNA 
0   19  NM_139681.1  CG13705-RA (CG13705), mRNA 
0   NM_132273.1  CG2004-RA (CG2004), mRNA 
0   NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_168938.1  CG7383-RB, transcript variant B (eg), mRNA 
0   NM_169990.1  CG6343-RB, transcript variant B (ND42), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_142853.1  CG6688-RA (CG6688), mRNA 
0   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   NM_140349.2  CG10948-RB, transcript variant B (CG10948), mRNA 
0   NM_168524.1  CG10948-RC, transcript variant C (CG10948), mRNA 
0   NM_168525.1  CG10948-RA, transcript variant A (CG10948), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_141383.1  CG15189-RA (Osi19), mRNA 
0   NM_137252.2  CG8445-RA, transcript variant A (CG8445), mRNA 
0   NM_176194.1  CG8445-RB, transcript variant B (CG8445), mRNA 
0   NM_142314.2  CG10324-RA (CG10324), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_057798.2  CG1650-RA (unpg), mRNA 
0   NM_143237.2  CG5480-RA (CG5480), mRNA 
0   10  NM_132778.1  CG9095-RA (CG9095), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.