National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13297R-2 
 Symbol CG13297  Full Name CG13297 
 CG No CG13297  Old CG No CG13297 
 Synonyms BcDNA:RE64858, CG13297 
 Accession No (Link to NCBI) NM_139773.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAGTCTATCCTCGGTGCCAA 
 Primer Seq. 3'
aatctagaggtaccGGCCAGAGATGCAAGAGATTT 
 Predicted Fragment Size
407 
 IR fragment full Seq
0001 TGAGTCTATC CTCGGTGCCA AGCAGCATTC AGCATGGGAA CAAGGTAACG CGCTGTGGCC 
0061 TGAGCATCAA CAATAAACTA GTGCAGGCCC TGATCCTCCT TTTGGCCTGC ATTCTCTTTG 
0121 GTGCCAACAT GAACTACGCC TCCTTTCCAC CTGGCACTGT CATCGATATC AAGCTGGGAG 
0181 ATGTCGCCCT CGAGCAGTTC AGCTATACGC CAACCCGCGA TGGATACGAG TTCAACTACA 
0241 CTCTTCCTGA TGGAACTTTT CGTGATGAGG TTGGCAAGGT CCTGAGTGGA ACTTCAGCTG 
0301 CCCAGGATCT GGAAAATGCC AACAACTTGG CCAAGAACCA CCGTCCCTCG CGTCAACAGG 
0361 GCCTTAAGGT TCGCAAGTTG TCCGGAAAAT CTCTTGCATT CTNCTggNC 
 in silico PCR Fragment
0001 TGAGTCTATC CTCGGTGCCA AGCAGCATTC AGCATGGGAA CAAGGTAACG CGCTGTGGCC 
0061 TGAGCATCAA CAATAAACTA GTGCAGGCCC TGATCCTCCT TTTGGCCTGC ATTCTCTTTG 
0121 GTGCCAACAT GAACTACGCC TCCTTTCCAC CTGGCACTGT CATCGATATC AAGCTGGGAG 
0181 ATGTCGCCCT CGAGCAGTTC AGCTATACGC CAACCCGCGA TGGATACGAG TTCAACTACA 
0241 CTCTTCCTGA TGGAACTTTT CGTGATGAGG TTGGCAAGGT CCTGAGTGGA ACTTCAGCTG 
0301 CCCAGGATCT GGAAAATGCC AACAACTTGG CCAAGAACCA CCGTCCCTCG CGTCAACAGG 
0361 GCCTTAAGGT TCGCAAGTTG TCCGGAAAAT CTCTTGCA-T CT-CTGGCC 
 Assemble Data

13297R-2.IR_full       1   TGAGTCTATCCTCGGTGCCAAGCAGCATTCAGCATGGGAACAAGGTAACGCGCTGTGGCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     1   TGAGTCTATCCTCGGTGCCAAGCAGCATTCAGCATGGGAACAAGGTAACGCGCTGTGGCC 60


13297R-2.IR_full       61  TGAGCATCAACAATAAACTAGTGCAGGCCCTGATCCTCCTTTTGGCCTGCATTCTCTTTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     61  TGAGCATCAACAATAAACTAGTGCAGGCCCTGATCCTCCTTTTGGCCTGCATTCTCTTTG 120


13297R-2.IR_full       121 GTGCCAACATGAACTACGCCTCCTTTCCACCTGGCACTGTCATCGATATCAAGCTGGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     121 GTGCCAACATGAACTACGCCTCCTTTCCACCTGGCACTGTCATCGATATCAAGCTGGGAG 180


13297R-2.IR_full       181 ATGTCGCCCTCGAGCAGTTCAGCTATACGCCAACCCGCGATGGATACGAGTTCAACTACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     181 ATGTCGCCCTCGAGCAGTTCAGCTATACGCCAACCCGCGATGGATACGAGTTCAACTACA 240


13297R-2.IR_full       241 CTCTTCCTGATGGAACTTTTCGTGATGAGGTTGGCAAGGTCCTGAGTGGAACTTCAGCTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     241 CTCTTCCTGATGGAACTTTTCGTGATGAGGTTGGCAAGGTCCTGAGTGGAACTTCAGCTG 300


13297R-2.IR_full       301 CCCAGGATCTGGAAAATGCCAACAACTTGGCCAAGAACCACCGTCCCTCGCGTCAACAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13297R-2.in silico     301 CCCAGGATCTGGAAAATGCCAACAACTTGGCCAAGAACCACCGTCCCTCGCGTCAACAGG 360


13297R-2.IR_full       361 GCCTTAAGGTTCGCAAGTTGTCCGGAAAATCTCTTGCATTCTNCTGGNC 409
                           |||||||||||||||||||||||||||||||||||||| ||| |||| |
13297R-2.in silico     361 GCCTTAAGGTTCGCAAGTTGTCCGGAAAATCTCTTGCA-TCT-CTGGCC 409

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   389  NM_139773.2  CG13297-RA (CG13297), mRNA 
0   NM_131971.2  CG4068-RA, transcript variant A (CG4068), mRNA 
0   NM_206627.1  CG4068-RB, transcript variant B (CG4068), mRNA 
0   NM_169646.2  CG6236-RB, transcript variant B (CG6236), mRNA 
0   NM_142189.3  CG6236-RA, transcript variant A (CG6236), mRNA 
0   NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0   NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0   NM_137937.2  CG3502-RA (CG3502), mRNA 
0   NM_166246.1  CG6424-RA, transcript variant A (CG6424), mRNA 
0   NM_137405.2  CG6424-RB, transcript variant B (CG6424), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_135436.1  CG17005-RA (CG17005), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_132289.1  CG10970-RA (CG10970), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_142273.2  CG12785-RA (CG12785), mRNA 
0   NM_137256.1  CG15701-RA (CG15701), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_142428.1  CG12321-RA (CG12321), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_079493.2  CG11254-RA, transcript variant A (mael), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.