National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1316R-1 
 Symbol CG1316  Full Name CG1316 
 CG No CG1316  Old CG No CG1316 
 Synonyms cg1316, CG1316 
 Accession No (Link to NCBI) NM_139630.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGGAGTACTCGAACGACGACGATCCGCCGATGTCGCGTCTCTTCATCATTTGCAACAAGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCACACCGAGGAGGATTTCCGTGAAGCCTTCTCGCCATACGGCGAAATCGAGGATATCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGTGGTGAAGGACAAGCACACCCAGGAGAACAAGGGAATCGCGTACGTCAAGTTCTCCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGACATCCGATGCTGCCAAGGCACAGGAGGAGATGAACGGCAAGACCATTGGCAAGATGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCGCACCCTTAAAGTCCTGGTGGCAGCCAATCGCAATCAGGGCTCAAATAAGTCTGAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGAGCAGGAGAAGTACGTGAGACTCTTCATAGTGATCCCCAAAACAGCCACCGAGGAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATATTCGCGAGGAATTCTCGCAGTGGGGCGATGTGGAATCTGTCACAATTGTCAAGGAGA 420

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGAACAATGGCAATCCCAAGGGCTTCGGATATGTCCGCTTTACCAAGTTTTACTATGCAG 480

1316R-1.IR_full       481 CTGTGGCTTTCGAAAANTGC 500
                          |||||||||||||||| ||| silico     481 CTGTGGCTTTCGAAAACTGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139630.1  CG1316-RA (CG1316), mRNA 
0   NM_167257.1  CG1637-RA, transcript variant A (CG1637), mRNA 
0   NM_137736.1  CG15666-RA (CG15666), mRNA 
0   NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   NM_139910.2  CG8209-RA (CG8209), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_167744.3  CG1693-RB, transcript variant B (tty), mRNA 
0   NM_080712.5  CG1693-RA, transcript variant A (tty), mRNA 
0   NM_140773.1  CG5137-RA (Cyp312a1), mRNA 
0   NM_057514.3  CG8153-RB, transcript variant B (mus210), mRNA 
0   NM_206507.1  CG7156-RB, transcript variant B (CG7156), mRNA 
0   NM_142440.2  CG7156-RA, transcript variant A (CG7156), mRNA 
0   NM_078983.2  CG8439-RA, transcript variant A (Cct5), mRNA 
0   NM_165867.1  CG8439-RB, transcript variant B (Cct5), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_169249.1  CG31100-RA (CG31100), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   10  NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   10  NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   10  NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_135123.2  CG9021-RA (CG9021), mRNA 
0   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   NM_138269.1  CG12086-RA (cue), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.