National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13139R-1 
 Symbol CG13139  Full Name CG13139 
 CG No CG13139  Old CG No CG13139 
 Synonyms CG13139 
 Accession No (Link to NCBI) NM_135546.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Mao Y, Kucuk B, Irvine KD.
Drosophila lowfat, a novel modulator of Fat signaling.
Development (2009) 136(19) 3223-33 [ PubMed ID = 19710173 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGTCTATCCCGAAGAACCTTTTTGGGTTTTACCAACCGTAACTGGATTTTACGAGGATAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGATTATAGAGTAAATGTCGTTGAAGCCCTACAAGAGTTTTGGCAAATGAAGCAGTCTCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGAGCTGAATTGAAAAATGGAGCTCTTGTGATTTACGAATCGATTCCGTCTAATAGCCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCATACATTTGCTTCGTAACACTTCCTGGAGGAAGCTGCTTTGGAAGTTTTCAAAACTG 240

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCCACCAAGGCAGAGGCTCGTCGCAGTTCGGCCAAGATCGCCCTAATGAATTCCGTCTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TAATGAGCATCCATCGCGTCGAATCAGCGATGAGTTCATTCAAAAGGCGGTTCAGGATGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCGCACTTCCTTCAAGGGCACATCGCAAATCAACGAGGGCACAGAATCGGGCATCGGAGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTCAGATTCATGCTGGAGGCGAACAAGGGAAGAACCATGCTGGAGTTCCAGGAGCTTAT 480

13139R-1.IR_full       481 GACCGTGTTCCAACTGCTTC 500
                           |||||||||||||||||||| silico     481 GACCGTGTTCCAACTGCTTC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135546.1  CG13139-RA (CG13139), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   11  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_001038917.1  CG33991-RF, transcript variant F (nuf), mRNA 
0   NM_001038919.1  CG33991-RE, transcript variant E (nuf), mRNA 
0   NM_001038921.1  CG33991-RD, transcript variant D (nuf), mRNA 
0   NM_001038918.1  CG33991-RB, transcript variant B (nuf), mRNA 
0   NM_001038920.1  CG33991-RC, transcript variant C (nuf), mRNA 
0   NM_137403.3  CG14485-RA (swi2), mRNA 
0   NM_140964.2  CG5282-RA (CG5282), mRNA 
0   NM_143170.2  CG17195-RA (CG17195), mRNA 
0   NM_136657.2  CG1818-RA (Updo), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_139516.1  CG12082-RA (CG12082), mRNA 
0   10  NM_140276.2  CG6947-RA (CG6947), mRNA 
0   NM_166736.1  CG2316-RB, transcript variant B (CG2316), mRNA 
0   NM_166737.1  CG2316-RC, transcript variant C (CG2316), mRNA 
0   NM_166738.1  CG2316-RD, transcript variant D (CG2316), mRNA 
0   NM_166739.1  CG2316-RE, transcript variant E (CG2316), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_143649.1  CG2316-RA, transcript variant A (CG2316), mRNA 
0   NM_166740.1  CG2316-RG, transcript variant G (CG2316), mRNA 
0   NM_166741.1  CG2316-RF, transcript variant F (CG2316), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.