National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 13139R-1 
 Symbol CG13139  Full Name CG13139 
 CG No CG13139  Old CG No CG13139 
 Synonyms CG13139 
 Accession No (Link to NCBI) NM_135546.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Mao Y, Kucuk B, Irvine KD.
Drosophila lowfat, a novel modulator of Fat signaling.
Development (2009) 136(19) 3223-33 [ PubMed ID = 19710173 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTCTATCCCGAAGAACCTTT 
 Primer Seq. 3'
aatctagaggtaccGAAGCAGTTGGAACACGGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNTCTATCCC GAAGAACCTT TTTGGGTTTT ACCAACCGTA ACTGGATTTT ACGAGGATAG 
0061 AGATTATAGA GTAAATGTCG TTGAAGCCCT ACAAGAGTTT TGGCAAATGA AGCAGTCTCG 
0121 TGGAGCTGAA TTGAAAAATG GAGCTCTTGT GATTTACGAA TCGATTCCGT CTAATAGCCA 
0181 GCCATACATT TGCTTCGTAA CACTTCCTGG AGGAAGCTGC TTTGGAAGTT TTCAAAACTG 
0241 TCCCACCAAG GCAGAGNCTC GTCGCAGTTC GGCCAAGATC GCCCTAATGA ATTCCGTCTT 
0301 TAATGAGCAT CCATCGCGTC GAATCAGCGA TGAGTTCATT CAAAAGGCGG TTCAGGATGC 
0361 TCGCACTTCC TTCAAGGGCA CATCGCAAAT CAACGAGGGC ACAGAATCGG GCATCGGAGC 
0421 ATTCAGATTC ATGCTGGAGG CGAACAAGGG AAGAACCATG CTGGAGTTCC AGGAGCTTAT 
0481 GACCGTGTTC CAACTGCTTC  
 in silico PCR Fragment
0001 GGTCTATCCC GAAGAACCTT TTTGGGTTTT ACCAACCGTA ACTGGATTTT ACGAGGATAG 
0061 AGATTATAGA GTAAATGTCG TTGAAGCCCT ACAAGAGTTT TGGCAAATGA AGCAGTCTCG 
0121 TGGAGCTGAA TTGAAAAATG GAGCTCTTGT GATTTACGAA TCGATTCCGT CTAATAGCCA 
0181 GCCATACATT TGCTTCGTAA CACTTCCTGG AGGAAGCTGC TTTGGAAGTT TTCAAAACTG 
0241 TCCCACCAAG GCAGAGGCTC GTCGCAGTTC GGCCAAGATC GCCCTAATGA ATTCCGTCTT 
0301 TAATGAGCAT CCATCGCGTC GAATCAGCGA TGAGTTCATT CAAAAGGCGG TTCAGGATGC 
0361 TCGCACTTCC TTCAAGGGCA CATCGCAAAT CAACGAGGGC ACAGAATCGG GCATCGGAGC 
0421 ATTCAGATTC ATGCTGGAGG CGAACAAGGG AAGAACCATG CTGGAGTTCC AGGAGCTTAT 
0481 GACCGTGTTC CAACTGCTTC  
 Assemble Data

13139R-1.IR_full       1   GNTCTATCCCGAAGAACCTTTTTGGGTTTTACCAACCGTAACTGGATTTTACGAGGATAG 60
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     1   GGTCTATCCCGAAGAACCTTTTTGGGTTTTACCAACCGTAACTGGATTTTACGAGGATAG 60


13139R-1.IR_full       61  AGATTATAGAGTAAATGTCGTTGAAGCCCTACAAGAGTTTTGGCAAATGAAGCAGTCTCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     61  AGATTATAGAGTAAATGTCGTTGAAGCCCTACAAGAGTTTTGGCAAATGAAGCAGTCTCG 120


13139R-1.IR_full       121 TGGAGCTGAATTGAAAAATGGAGCTCTTGTGATTTACGAATCGATTCCGTCTAATAGCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     121 TGGAGCTGAATTGAAAAATGGAGCTCTTGTGATTTACGAATCGATTCCGTCTAATAGCCA 180


13139R-1.IR_full       181 GCCATACATTTGCTTCGTAACACTTCCTGGAGGAAGCTGCTTTGGAAGTTTTCAAAACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     181 GCCATACATTTGCTTCGTAACACTTCCTGGAGGAAGCTGCTTTGGAAGTTTTCAAAACTG 240


13139R-1.IR_full       241 TCCCACCAAGGCAGAGNCTCGTCGCAGTTCGGCCAAGATCGCCCTAATGAATTCCGTCTT 300
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     241 TCCCACCAAGGCAGAGGCTCGTCGCAGTTCGGCCAAGATCGCCCTAATGAATTCCGTCTT 300


13139R-1.IR_full       301 TAATGAGCATCCATCGCGTCGAATCAGCGATGAGTTCATTCAAAAGGCGGTTCAGGATGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     301 TAATGAGCATCCATCGCGTCGAATCAGCGATGAGTTCATTCAAAAGGCGGTTCAGGATGC 360


13139R-1.IR_full       361 TCGCACTTCCTTCAAGGGCACATCGCAAATCAACGAGGGCACAGAATCGGGCATCGGAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     361 TCGCACTTCCTTCAAGGGCACATCGCAAATCAACGAGGGCACAGAATCGGGCATCGGAGC 420


13139R-1.IR_full       421 ATTCAGATTCATGCTGGAGGCGAACAAGGGAAGAACCATGCTGGAGTTCCAGGAGCTTAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
13139R-1.in silico     421 ATTCAGATTCATGCTGGAGGCGAACAAGGGAAGAACCATGCTGGAGTTCCAGGAGCTTAT 480


13139R-1.IR_full       481 GACCGTGTTCCAACTGCTTC 500
                           ||||||||||||||||||||
13139R-1.in silico     481 GACCGTGTTCCAACTGCTTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135546.1  CG13139-RA (CG13139), mRNA 
0   NM_144487.1  CG5518-RA (sda), mRNA 
0   11  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_001038917.1  CG33991-RF, transcript variant F (nuf), mRNA 
0   NM_001038919.1  CG33991-RE, transcript variant E (nuf), mRNA 
0   NM_001038921.1  CG33991-RD, transcript variant D (nuf), mRNA 
0   NM_001038918.1  CG33991-RB, transcript variant B (nuf), mRNA 
0   NM_001038920.1  CG33991-RC, transcript variant C (nuf), mRNA 
0   NM_137403.3  CG14485-RA (swi2), mRNA 
0   NM_140964.2  CG5282-RA (CG5282), mRNA 
0   NM_143170.2  CG17195-RA (CG17195), mRNA 
0   NM_136657.2  CG1818-RA (Updo), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_139516.1  CG12082-RA (CG12082), mRNA 
0   10  NM_140276.2  CG6947-RA (CG6947), mRNA 
0   NM_166736.1  CG2316-RB, transcript variant B (CG2316), mRNA 
0   NM_166737.1  CG2316-RC, transcript variant C (CG2316), mRNA 
0   NM_166738.1  CG2316-RD, transcript variant D (CG2316), mRNA 
0   NM_166739.1  CG2316-RE, transcript variant E (CG2316), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_143649.1  CG2316-RA, transcript variant A (CG2316), mRNA 
0   NM_166740.1  CG2316-RG, transcript variant G (CG2316), mRNA 
0   NM_166741.1  CG2316-RF, transcript variant F (CG2316), mRNA 
0   NM_141607.1  CG11033-RA (CG11033), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.