National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12951R-2 
 Symbol CG12951  Full Name CG12951 
 CG No CG12951  Old CG No CG12951 
 Synonyms SP87, CG12951 
 Accession No (Link to NCBI) NM_141623.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGCGCCTTCCATATCAAGGGTGGTCAATGGTACGGACTCCAGTGTGCTGAAATATCCTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGTGGTATCCCTAAGGAGCTACGATGGCTCGCATTCCTGCGGTGGTTCTATTATTTCAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACATTTTGTGATGACCGCTGCTCATTGCACCAATGGTCGACCTGCGGATACCCTATCAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCAGTTTGGAGTGACCAATATTAGTGCCATGGGTCCGAATGTGGTGGGCATAAAGAAGA 240

                           |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     241 TAATCCAGCACGAAGACTTTGATCCCACTCGCCAAAATGCAAATGACATCTCGCTGCTGA 300

                           |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| silico     301 TGGTGGAGGAACCTTTTGAGTTCGATGGCGTCTCTGTGGCCCCGGTGGAACTGCCAGCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGCTTTTGCTGTGCCTCAATCGGATGCTGGAGTCGAAGGAGTGCTCATCGGTTGGGGTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAATGATACTTATGGAAGTGTGCAGGACACCCTACAGGAGGTTTCCCTGAAGATTTACT 480

12951R-2.IR_full       481 CGGATGAAGAGTGCACCAGC 500
                           |||||||||||||||||||| silico     481 CGGATGAAGAGTGCACCAGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141623.1  CG12951-RA (CG12951), mRNA 
0.62   51  75  NM_141624.1  CG16749-RA (CG16749), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_142640.2  CG16953-RA (CG16953), mRNA 
0   NM_166171.2  CG30098-RA (CG30098), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0   NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0   NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0   NM_169191.2  CG31146-RD (CG31146), mRNA 
0   NM_136231.2  CG9342-RA (CG9342), mRNA 
0   NM_145883.2  CG13425-RB, transcript variant B (bl), mRNA 
0   NM_206185.1  CG13425-RA, transcript variant A (bl), mRNA 
0   NM_079106.2  CG4817-RA (Ssrp), mRNA 
0   NM_206184.1  CG13425-RC, transcript variant C (bl), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   NM_080379.3  CG5472-RA, transcript variant A (Pal), mRNA 
0   NM_206208.1  CG5472-RB, transcript variant B (Pal), mRNA 
0   NM_206207.1  CG5472-RC, transcript variant C (Pal), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
0   NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
0   NM_206740.1  CG16952-RC, transcript variant C (CG16952), mRNA 
0   NM_132857.2  CG16952-RA, transcript variant A (CG16952), mRNA 
0   NM_206741.1  CG16952-RB, transcript variant B (CG16952), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.