National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12951R-1 
 Symbol CG12951  Full Name CG12951 
 CG No CG12951  Old CG No CG12951 
 Synonyms SP87, CG12951 
 Accession No (Link to NCBI) NM_141623.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCGCCTTCCATATCAAGGG 
 Primer Seq. 3'
aatctagaggtaccGCTGGTGCACTCTTCATCCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGCgCCTTC CATATCAAGG GTGGTCAATG GTACGGACTC CAGTGTGCTG AAATATCCTT 
0061 TCGTGGTATC CCTAAGGAGC TACGATGGCT CGCATTCCTG CGGTGGTTCT ATTATTTCAA 
0121 AACATTTTGT GATGACCGCT GCTCATTGCA CCAATGGTCG ACCTGCGGAT ACCCTATCAA 
0181 TTCAGTTTGG AGTGACCAAT ATTAGTGCCA TGGGTCCGAA TGTGGTGGGC ATAAAGAAGA 
0241 TAATCCAGCA CGAAGACTTT GATCCCACTC GCCAAAATGC CAATGACATC TCGCTGCTGA 
0301 TGGTGGAGGA ACCTTTTGAG TTCGATGGCG TCTCTGTGGC TCCGGTGGAA TTGCCAGCTC 
0361 TGGCTTTTGC TGTGCCTCAA TCGGATGCTG GAGTCGAAGG AGTGCTCATC GGTTGGGGTC 
0421 TCAATGATAC TTATGGAAGT GTGCAGGACA CCCTACAGGA GGTTTCCCTG AAGATTTACT 
0481 CGGATGAAGA GTGCACCAGC  
 in silico PCR Fragment
0001 CCGCGCCTTC CATATCAAGG GTGGTCAATG GTACGGACTC CAGTGTGCTG AAATATCCTT 
0061 TCGTGGTATC CCTAAGGAGC TACGATGGCT CGCATTCCTG CGGTGGTTCT ATTATTTCAA 
0121 AACATTTTGT GATGACCGCT GCTCATTGCA CCAATGGTCG ACCTGCGGAT ACCCTATCAA 
0181 TTCAGTTTGG AGTGACCAAT ATTAGTGCCA TGGGTCCGAA TGTGGTGGGC ATAAAGAAGA 
0241 TAATCCAGCA CGAAGACTTT GATCCCACTC GCCAAAATGC AAATGACATC TCGCTGCTGA 
0301 TGGTGGAGGA ACCTTTTGAG TTCGATGGCG TCTCTGTGGC CCCGGTGGAA CTGCCAGCTC 
0361 TGGCTTTTGC TGTGCCTCAA TCGGATGCTG GAGTCGAAGG AGTGCTCATC GGTTGGGGTC 
0421 TCAATGATAC TTATGGAAGT GTGCAGGACA CCCTACAGGA GGTTTCCCTG AAGATTTACT 
0481 CGGATGAAGA GTGCACCAGC  
 Assemble Data

12951R-1.IR_full       1   CCGCGCCTTCCATATCAAGGGTGGTCAATGGTACGGACTCCAGTGTGCTGAAATATCCTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     1   CCGCGCCTTCCATATCAAGGGTGGTCAATGGTACGGACTCCAGTGTGCTGAAATATCCTT 60


12951R-1.IR_full       61  TCGTGGTATCCCTAAGGAGCTACGATGGCTCGCATTCCTGCGGTGGTTCTATTATTTCAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     61  TCGTGGTATCCCTAAGGAGCTACGATGGCTCGCATTCCTGCGGTGGTTCTATTATTTCAA 120


12951R-1.IR_full       121 AACATTTTGTGATGACCGCTGCTCATTGCACCAATGGTCGACCTGCGGATACCCTATCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     121 AACATTTTGTGATGACCGCTGCTCATTGCACCAATGGTCGACCTGCGGATACCCTATCAA 180


12951R-1.IR_full       181 TTCAGTTTGGAGTGACCAATATTAGTGCCATGGGTCCGAATGTGGTGGGCATAAAGAAGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     181 TTCAGTTTGGAGTGACCAATATTAGTGCCATGGGTCCGAATGTGGTGGGCATAAAGAAGA 240


12951R-1.IR_full       241 TAATCCAGCACGAAGACTTTGATCCCACTCGCCAAAATGCCAATGACATCTCGCTGCTGA 300
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
12951R-1.in silico     241 TAATCCAGCACGAAGACTTTGATCCCACTCGCCAAAATGCAAATGACATCTCGCTGCTGA 300


12951R-1.IR_full       301 TGGTGGAGGAACCTTTTGAGTTCGATGGCGTCTCTGTGGCTCCGGTGGAATTGCCAGCTC 360
                           |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||
12951R-1.in silico     301 TGGTGGAGGAACCTTTTGAGTTCGATGGCGTCTCTGTGGCCCCGGTGGAACTGCCAGCTC 360


12951R-1.IR_full       361 TGGCTTTTGCTGTGCCTCAATCGGATGCTGGAGTCGAAGGAGTGCTCATCGGTTGGGGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     361 TGGCTTTTGCTGTGCCTCAATCGGATGCTGGAGTCGAAGGAGTGCTCATCGGTTGGGGTC 420


12951R-1.IR_full       421 TCAATGATACTTATGGAAGTGTGCAGGACACCCTACAGGAGGTTTCCCTGAAGATTTACT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12951R-1.in silico     421 TCAATGATACTTATGGAAGTGTGCAGGACACCCTACAGGAGGTTTCCCTGAAGATTTACT 480


12951R-1.IR_full       481 CGGATGAAGAGTGCACCAGC 500
                           ||||||||||||||||||||
12951R-1.in silico     481 CGGATGAAGAGTGCACCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141623.1  CG12951-RA (CG12951), mRNA 
0.62   51  75  NM_141624.1  CG16749-RA (CG16749), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_142640.2  CG16953-RA (CG16953), mRNA 
0   NM_166171.2  CG30098-RA (CG30098), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0   NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0   NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0   NM_169191.2  CG31146-RD (CG31146), mRNA 
0   NM_136231.2  CG9342-RA (CG9342), mRNA 
0   NM_145883.2  CG13425-RB, transcript variant B (bl), mRNA 
0   NM_206185.1  CG13425-RA, transcript variant A (bl), mRNA 
0   NM_079106.2  CG4817-RA (Ssrp), mRNA 
0   NM_206184.1  CG13425-RC, transcript variant C (bl), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   NM_080379.3  CG5472-RA, transcript variant A (Pal), mRNA 
0   NM_206208.1  CG5472-RB, transcript variant B (Pal), mRNA 
0   NM_206207.1  CG5472-RC, transcript variant C (Pal), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
0   NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
0   NM_206740.1  CG16952-RC, transcript variant C (CG16952), mRNA 
0   NM_132857.2  CG16952-RA, transcript variant A (CG16952), mRNA 
0   NM_206741.1  CG16952-RB, transcript variant B (CG16952), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
DC
++ 
DM
VM
VB
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.