National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12918R-2 
 Symbol CG12918  Full Name CG12918 
 CG No CG12918  Old CG No CG12918 
 Synonyms CG12918 
 Accession No (Link to NCBI) NM_136703.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTGACGAAGGCGCTTATC 
 Primer Seq. 3'
aatctagaggtaccCGCTTGTTCTGAGCAGATCTT 
 Predicted Fragment Size
507 
 IR fragment full Seq
0001 ATGCTGACGA AGGCGCTTAT CCTGTTCGGC CTGCTgGCCT TGGCCCAAGG TTACAGCTTC 
0061 ACCTCCCGCG AGGTCAAGTG TCACGTGTGC AAGGCCGTGG TTACGGAACT GGAGGAGGCC 
0121 ATTGCCAAGG AGGACCCCCA CAAGATGGCC GATGTCAGTG GATTCCGGCT GGACGCACAG 
0181 GGAAATTCGA TCAGCAAGAA AGTTCGCCTA GTGAAATCTG AAATGTTCCT TACCGAACTG 
0241 ATGGAGAAGA TCTGCGAAAA AATGGACGAC TACTTGAAGG CAACCTACAA GAGCAACGGG 
0301 AAATTCACAC TCCTCAAGAT GATCATCAAT GGTCAGATGA ACCCAGACTC CTCGTTGGTT 
0361 GACTTTGTGC AAGATGGTGA TCTCAACAAA AGCCTGGGGC ACTTCTGCAA CGAAGTACTG 
0421 GAGGACAACG ATGAGATCTT CGTTAAAGCC TTCCAGGCCG AAGAGCTCGG AAACGATTTA 
0481 GACATCAAGA TCTGCTCAGA ACAANCG 
 in silico PCR Fragment
0001 ATGCTGACGA AGGCGCTTAT CCTGTTCGGC CTGCTGGCCT TGGCCCAAGG TTACAGCTTC 
0061 ACCTCCCGCG AGGTCAAGTG TCACGTGTGC AAGGCCGTGG TTACGGAACT GGAGGAGGCC 
0121 ATTGCCAAGG AGGACCCCCA CAAGATGGCC GATGTCAGTG GATTCCGGCT GGACGCACAG 
0181 GGAAATTCGA TCAGCAAGAA AGTTCGCCTA GTGAAATCTG AAATGTTCCT TACCGAACTG 
0241 ATGGAGAAGA TCTGCGAAAA AATGGACGAC TACTTGAAGG CAACCTACAA GAGCAACGGG 
0301 AAATTCACAC TCCTCAAGAT GATCATCAAT GGTCAGATGA ACCCAGACTC CTCGTTGGTT 
0361 GACTTTGTGC AAGATGGTGA TCTCAACAAA AGCCTGGGGC ACTTCTGCAA CGAAGTACTG 
0421 GAGGACAACG ATGAGATCTT CGTTAAAGCC TTCCAGGCCG AAGAGCTCGG AAACGATTTA 
0481 GACATCAAGA TCTGCTCAGA ACAAGCG 
 Assemble Data

12918R-2.IR_full       1   ATGCTGACGAAGGCGCTTATCCTGTTCGGCCTGCTGGCCTTGGCCCAAGGTTACAGCTTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     1   ATGCTGACGAAGGCGCTTATCCTGTTCGGCCTGCTGGCCTTGGCCCAAGGTTACAGCTTC 60


12918R-2.IR_full       61  ACCTCCCGCGAGGTCAAGTGTCACGTGTGCAAGGCCGTGGTTACGGAACTGGAGGAGGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     61  ACCTCCCGCGAGGTCAAGTGTCACGTGTGCAAGGCCGTGGTTACGGAACTGGAGGAGGCC 120


12918R-2.IR_full       121 ATTGCCAAGGAGGACCCCCACAAGATGGCCGATGTCAGTGGATTCCGGCTGGACGCACAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     121 ATTGCCAAGGAGGACCCCCACAAGATGGCCGATGTCAGTGGATTCCGGCTGGACGCACAG 180


12918R-2.IR_full       181 GGAAATTCGATCAGCAAGAAAGTTCGCCTAGTGAAATCTGAAATGTTCCTTACCGAACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     181 GGAAATTCGATCAGCAAGAAAGTTCGCCTAGTGAAATCTGAAATGTTCCTTACCGAACTG 240


12918R-2.IR_full       241 ATGGAGAAGATCTGCGAAAAAATGGACGACTACTTGAAGGCAACCTACAAGAGCAACGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     241 ATGGAGAAGATCTGCGAAAAAATGGACGACTACTTGAAGGCAACCTACAAGAGCAACGGG 300


12918R-2.IR_full       301 AAATTCACACTCCTCAAGATGATCATCAATGGTCAGATGAACCCAGACTCCTCGTTGGTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     301 AAATTCACACTCCTCAAGATGATCATCAATGGTCAGATGAACCCAGACTCCTCGTTGGTT 360


12918R-2.IR_full       361 GACTTTGTGCAAGATGGTGATCTCAACAAAAGCCTGGGGCACTTCTGCAACGAAGTACTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     361 GACTTTGTGCAAGATGGTGATCTCAACAAAAGCCTGGGGCACTTCTGCAACGAAGTACTG 420


12918R-2.IR_full       421 GAGGACAACGATGAGATCTTCGTTAAAGCCTTCCAGGCCGAAGAGCTCGGAAACGATTTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12918R-2.in silico     421 GAGGACAACGATGAGATCTTCGTTAAAGCCTTCCAGGCCGAAGAGCTCGGAAACGATTTA 480


12918R-2.IR_full       481 GACATCAAGATCTGCTCAGAACAANCG 507
                           |||||||||||||||||||||||| ||
12918R-2.in silico     481 GACATCAAGATCTGCTCAGAACAAGCG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   489  NM_136703.3  CG12918-RA (CG12918), mRNA 
0   NM_139692.1  CG4611-RA (CG4611), mRNA 
0   NM_143632.2  CG2196-RA (CG2196), mRNA 
0   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 
0   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0   NM_132890.2  CG3692-RA (CalpC), mRNA 
0   10  NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_166102.1  CG8200-RB, transcript variant B (Flo), mRNA 
0   NM_058010.3  CG8200-RA, transcript variant A (Flo), mRNA 
0   NM_164827.1  CG17834-RC, transcript variant C (CG17834), mRNA 
0   NM_135398.2  CG17834-RA, transcript variant A (CG17834), mRNA 
0   NM_167634.1  CG7088-RB, transcript variant B (bnb), mRNA 
0   NM_078682.2  CG7088-RC, transcript variant C (bnb), mRNA 
0   NM_135525.1  CG5604-RA (CG5604), mRNA 
0   NM_167633.1  CG7088-RA, transcript variant A (bnb), mRNA 
0   NM_167635.1  CG7088-RD, transcript variant D (bnb), mRNA 
0   NM_141118.3  CG7470-RA (CG7470), mRNA 
0   NM_079516.2  CG1433-RA (Atu), mRNA 
0   NM_058064.3  CG10206-RA (nop5), mRNA 
0   NM_139846.2  CG8602-RA (CG8602), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_168722.1  CG6512-RB, transcript variant B (CG6512), mRNA 
0   NM_168720.1  CG6512-RA, transcript variant A (CG6512), mRNA 
0   NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   NM_135943.2  CG5869-RA (CG5869), mRNA 
0   NM_141003.2  CG3634-RA (CG3634), mRNA 
0   NM_166681.1  CG3683-RC, transcript variant C (CG3683), mRNA 
0   NM_166680.1  CG3683-RB, transcript variant B (CG3683), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.