National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12913R-1 
 Symbol CG12913  Full Name CG12913 
 CG No CG12913  Old CG No CG12913 
 Synonyms CG12913 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees  
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCCTGGTGACCAAGTTGCTG 
 Primer Seq. 3'
aatctagaggtaccCGTCGATAACCGATGGGCTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

12913R-1.IR full       1   TCCCTGGTGACCAAGTTGCTGCTGCGGCTTTTGCTGCTCTTCGCCTTGTTGACCGGCGCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     1   TCCCTGGTGACCAAGTTGCTGCTGCGGCTTTTGCTGCTCTTCGCCTTGTTGACCGGCGCC 60


12913R-1.IR full       61  TCCATTGTGGTGCTCACAAAGTGCGGATTCGATGAACTGACGACGAGGGAAACTCAAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     61  TCCATTGTGGTGCTCACAAAGTGCGGATTCGATGAACTGACGACGAGGGAAACTCAAGCC 120


12913R-1.IR full       121 AATAATCCGAGTGAATCCAGCGGATTCAGTTACACCTTAAGCGAACGAGAGGCGGAAATT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     121 AATAATCCGAGTGAATCCAGCGGATTCAGTTACACCTTAAGCGAACGAGAGGCGGAAATT 180


12913R-1.IR full       181 GAGCGGCTGAAACAGGAAGTCCTGGCTCTCCGCACTCAAATCATCTTTCTACAGAATAAT 240
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
12913R-1.in silico     181 GAGCGGCTGAAACAGGAAGTCCTGGCTCTCCGCACTCAAATCCTCTTTCTACAGAATAAT 240


12913R-1.IR full       241 CGCAGCACTGCCAAGCCATCAAATGGCAGTCTTCAATTGCAAGAAACCACCACGGGGCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
12913R-1.in silico     241 CGCAGCACTGCCAAGCCATCAAATGGCAGTCTTCAATTGCAAGAAACCACCGCGGGGCCA 300


12913R-1.IR full       301 CCAACTGCACCACTGGGTCACCATTACGACTGCAGCAGCTATATTCGCAAGCAGGTGGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     301 CCAACTGCACCACTGGGTCACCATTACGACTGCAGCAGCTATATTCGCAAGCAGGTGGGC 360


12913R-1.IR full       361 GCCGCAGAAATTCTGCATGGACTGCCGCTGAACAACGAGTACGAGCTGATACCCTACAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     361 GCCGCAGAAATTCTGCATGGACTGCCGCTGAACAACGAGTACGAGCTGATACCCTACAAT 420


12913R-1.IR full       421 CACTTCACCTTCACGCGAGTATATCCCATCGACTTGGGCCTGGGAAAGCGCGTGGTGGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12913R-1.in silico     421 CACTTCACCTTCACGCGAGTATATCCCATCGACTTGGGCCTGGGAAAGCGCGTGGTGGAG 480


12913R-1.IR full       481 AAGCCCATCGGTTATCGACG 500
                           ||||||||||||||||||||
12913R-1.in silico     481 AAGCCCATCGGTTATCGACG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_136723.1  CG12913-RA (CG12913), mRNA 
0.41  NM_078643.2  no on or off transient A CG4211-RA, transcript variant A (nonA), mRNA 
0.41  NM_001014747.1  no on or off transient A CG4211-RC, transcript variant C (nonA), mRNA 
0.41  NM_167505.1  no on or off transient A CG4211-RB, transcript variant B (nonA), mRNA 
0.2  10  NM_001032402.1  cp309 CG33957-RB, transcript variant B (cp309), mRNA 
0.2  NM_001032401.1  cp309 CG33957-RC, transcript variant C (cp309), mRNA 
0.2  NM_170152.1  CG13624-RD, transcript variant D (CG13624), mRNA 
0.2  NM_170151.1  CG13624-RB, transcript variant B (CG13624), mRNA 
0.2  NM_001043287.1  CG13624-RE, transcript variant E (CG13624), mRNA 
0.2  NM_170150.1  CG13624-RA, transcript variant A (CG13624), mRNA 
0.2  NM_001043288.1  CG13624-RF, transcript variant F (CG13624), mRNA 
0.2  NM_143014.2  CG13624-RC, transcript variant C (CG13624), mRNA 
NM_136825.1  Odorant-binding protein 47b CG13208-RA (Obp47b), mRNA 
NM_136826.1  CG7741-RA (CG7741), mRNA 
13  52  NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
27  NM_139660.3  CG32245-RA, transcript variant A (CG32245), mRNA 
27  NM_168095.2  CG32245-RC, transcript variant C (CG32245), mRNA 
17  NM_057502.2  Zn finger homeodomain 1 CG1322-RB, transcript variant B (zfh1), mRNA 
11  NM_170523.2  Zn finger homeodomain 1 CG1322-RA, transcript variant A (zfh1), mRNA 
NM_057956.2  D19A CG10269-RA (D19A), mRNA 
20  NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
20  NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
13  NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
13  NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
22  NM_135607.2  CG6495-RA (CG6495), mRNA 
20  NM_206271.1  Rdh CG14975-RA (Rdh), mRNA 
16  NM_167251.1  IGF-II mRNA-binding protein CG1691-RF, transcript variant F (Imp), mRNA 
16  NM_167253.1  IGF-II mRNA-binding protein CG1691-RH, transcript variant H (Imp), mRNA 
16  NM_167252.1  IGF-II mRNA-binding protein CG1691-RG, transcript variant G (Imp), mRNA 
16  NM_167249.1  IGF-II mRNA-binding protein CG1691-RD, transcript variant D (Imp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.