National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12908R-3 
 Symbol Ndg  Full Name Nidogen/entactin 
 CG No CG12908  Old CG No CG12908 
 Synonyms CG12908, ndg, CT32053, BEST:CK00552, Ndg 
 Accession No (Link to NCBI) NM_136731.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCGACCTTCGGCAGTAAG 
 Primer Seq. 3'
aatctagaggtaccAAGTAGCCCACATTGCGCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCCGACCT TCGgcAGTAA GTTGCTCGCC TGCCTGCTGC TCAGCTCGGT GATCCTGGTC 
0061 AGCGGACAGT TCGAGCACTA TCTGGACAGC CTGCACGCCT CGGAATTGTA CGAGTTCGAG 
0121 GATGGCTCCC TGGGCAGCAT ACACCTCTTG CCCAAGGGCG ACAGCGAAAC GATCGTTCTG 
0181 CAACTGGAGC AGCCCATTCA CTTCTACGGG GAGCAGTACG AGCAGCTCTA TATCAACACC 
0241 AATGGCATCC TCACCTTCAA CTCCGAGTTT CCCGAGTACC TGAACCAGCC CTTTCCGCTG 
0301 GAATATGCTT CGATAGCGGC CTTCTACTCG AACGTGGACA CCTCGTTCAG TGATGAGGGC 
0361 ACCTCGATCT CCCTGTTCGA GTCCAAGGAA CAAAGTATTC TCGACAGGGC CTCCAGTTTG 
0421 GTGCGTTACG CCTTTAGCAG CCAGTCTGAA TTCGAGGCTC GTCAGGTGAT CGTGGNCACG 
0481 TGGCGCAATG TGGGCTACTT  
 in silico PCR Fragment
0001 ATGCCGACCT TCGGCAGTAA GTTGCTCGCC TGCCTGCTGC TCAGCTCGGT GATCCTGGTC 
0061 AGCGGACAGT TCGAGCACTA TCTGGACAGC CTGCGCGCCT CGGAATTGTA CGAGTTCGAG 
0121 GATGGCTCCC TGGGCAGCAT ACACCTCTTG CCCAAGGGCG ACAGCGAAAC GATCGTGCTG 
0181 CAACTGGAGC AGCCCATTCA CTTCTACGGG GAGCAGTACG AGCAGCTCTA TATCAACACC 
0241 AATGGCATCC TCACCTTCAA CTCCGAGTTT CCCGAGTACC TGAACCAGCC CTTTCCGCTG 
0301 GAATATGCTT CGATAGCGGC CTTCTACTCG AACGTGGACA CCTCGTTCAG TGATGAGGGC 
0361 ACCTCGATCT CCCTGTTCGA GTCCAAGGAA CAAAGTATTC TCGACAGGGC CTCCAGTTTG 
0421 GTGCGTTACG CCTTTAGCAG CCAGTCTGAA TTCGAGGCTC GTCAGGTGAT CGTGGCCACG 
0481 TGGCGCAATG TGGGCTACTT  
 Assemble Data

12908R-3.IR_full       1   ATGCCGACCTTCGGCAGTAAGTTGCTCGCCTGCCTGCTGCTCAGCTCGGTGATCCTGGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12908R-3.in silico     1   ATGCCGACCTTCGGCAGTAAGTTGCTCGCCTGCCTGCTGCTCAGCTCGGTGATCCTGGTC 60


12908R-3.IR_full       61  AGCGGACAGTTCGAGCACTATCTGGACAGCCTGCACGCCTCGGAATTGTACGAGTTCGAG 120
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
12908R-3.in silico     61  AGCGGACAGTTCGAGCACTATCTGGACAGCCTGCGCGCCTCGGAATTGTACGAGTTCGAG 120


12908R-3.IR_full       121 GATGGCTCCCTGGGCAGCATACACCTCTTGCCCAAGGGCGACAGCGAAACGATCGTTCTG 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
12908R-3.in silico     121 GATGGCTCCCTGGGCAGCATACACCTCTTGCCCAAGGGCGACAGCGAAACGATCGTGCTG 180


12908R-3.IR_full       181 CAACTGGAGCAGCCCATTCACTTCTACGGGGAGCAGTACGAGCAGCTCTATATCAACACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12908R-3.in silico     181 CAACTGGAGCAGCCCATTCACTTCTACGGGGAGCAGTACGAGCAGCTCTATATCAACACC 240


12908R-3.IR_full       241 AATGGCATCCTCACCTTCAACTCCGAGTTTCCCGAGTACCTGAACCAGCCCTTTCCGCTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12908R-3.in silico     241 AATGGCATCCTCACCTTCAACTCCGAGTTTCCCGAGTACCTGAACCAGCCCTTTCCGCTG 300


12908R-3.IR_full       301 GAATATGCTTCGATAGCGGCCTTCTACTCGAACGTGGACACCTCGTTCAGTGATGAGGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12908R-3.in silico     301 GAATATGCTTCGATAGCGGCCTTCTACTCGAACGTGGACACCTCGTTCAGTGATGAGGGC 360


12908R-3.IR_full       361 ACCTCGATCTCCCTGTTCGAGTCCAAGGAACAAAGTATTCTCGACAGGGCCTCCAGTTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12908R-3.in silico     361 ACCTCGATCTCCCTGTTCGAGTCCAAGGAACAAAGTATTCTCGACAGGGCCTCCAGTTTG 420


12908R-3.IR_full       421 GTGCGTTACGCCTTTAGCAGCCAGTCTGAATTCGAGGCTCGTCAGGTGATCGTGGNCACG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
12908R-3.in silico     421 GTGCGTTACGCCTTTAGCAGCCAGTCTGAATTCGAGGCTCGTCAGGTGATCGTGGCCACG 480


12908R-3.IR_full       481 TGGCGCAATGTGGGCTACTT 500
                           ||||||||||||||||||||
12908R-3.in silico     481 TGGCGCAATGTGGGCTACTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206074.1  CG12908-RB, transcript variant B (Ndg), mRNA 
100   482  NM_136731.1  CG12908-RA, transcript variant A (Ndg), mRNA 
0   NM_166555.1  CG3510-RA, transcript variant A (CycB), mRNA 
0   NM_166556.1  CG3510-RD, transcript variant D (CycB), mRNA 
0   NM_166557.1  CG3510-RB, transcript variant B (CycB), mRNA 
0   NM_166558.1  CG3510-RC, transcript variant C (CycB), mRNA 
0   11  NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   11  NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   11  NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   11  NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   11  NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_057242.3  CG7765-RA (Khc), mRNA 
0   NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
0   NM_079693.2  CG4173-RA (Sep2), mRNA 
0   11  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
0   11  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
0   NM_140047.1  CG4461-RA (CG4461), mRNA 
0   NM_138063.2  CG13578-RA (CG13578), mRNA 
0   NM_140449.1  CG9592-RA (CG9592), mRNA 
0   NM_167869.1  CG9184-RA, transcript variant A (CG9184), mRNA 
0   NM_138255.1  CG9184-RB, transcript variant B (CG9184), mRNA 
0   NM_136442.3  CG1621-RA (CG1621), mRNA 
0   NM_137046.3  CG6191-RA (CG6191), mRNA 
0   24  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_079453.2  CG6975-RA (gig), mRNA 
0   NM_140973.1  CG5955-RA (CG5955), mRNA 
0   NM_167965.1  CG32296-RA (Mrtf), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_078795.2  CG18241-RA (Toll-4), mRNA 
0   NM_144078.1  CG18676-RA (Teh3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.