National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12866R-1 
 Symbol CG12866  Full Name CG12866 
 CG No CG12866  Old CG No CG12866 
 Synonyms CG12866 
 Accession No (Link to NCBI) NM_137136.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kim M, Jang D, Yoo E, Oh Y, Sonn JY, Lee J, Ki Y, Son HJ, Hwang O, Lee C, Lim C, Choe J.
Rogdi Defines GABAergic Control of a Wake-promoting Dopaminergic Pathway to Sustain Sleep in Drosophila.
Sci Rep (2017) 7(1) 11368 [ PubMed ID = 28900300 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGCACAGTTTCAACGGATA 
 Primer Seq. 3'
aatctagaggtaccGGTTTCCTTAGGGACCACATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGGCACAGT TTCAACGGAT ATCCTGAATG GGCGCACATC ATTCTTGTCC CTTAGTCCAG 
0061 TCCTCACGGG AGTGAAGTGG ATTTGCCTNC TTCGTTCTAC GAAAGCTTTA ATCCAACTTT 
0121 TCTTCCCAAG CTGCCTATCA GAAGATTTCC CCATATGCTT GTGGGGGCAT CAAATGAGCC 
0181 TGAGATTTCG NAAAAACCAG CCAGCAATTC CACCATCTAG GCCAATTGAG CCAATATCTG 
0241 AGGTGCCGTT TGTGGAACCG GCCTTTGAGA AAAAATACTC TAGGACCCGT GGATTTAGCA 
0301 AGGAATTGTC CACACACAGG GATAATGAGA ATGAATATGT CGAGAGCACA GATGAGGTGT 
0361 CTCAGATGTT GAGCTTTACT AGCTATACGG ATGAATATGA TAGGGCAGAA CCACTCATTA 
0421 CCAAAACGCA AAAGTTTTAT AAAAAGAGAT CCCCCTTGAT TCCCAAATAC GATTCCGAGG 
0481 ATTCATATGT GGTCCCTAAG GAAACC 
 in silico PCR Fragment
0001 TCGGCACAGT TTCAACGGAT ATCCTGAATG GGCGCACATC ATTCTTGTCC CTTAGT-CAG 
0061 T-CTCACGGG AGTGAAGTGG ATTTGC---C TTCGTTCTAC GAAAGCTTTA ATCCAACTTT 
0121 TCTTCCCAAG CTGCCTATCA GAAGATTTCC CCATATGCTT GTGGGGGCAT CAAATGAGCC 
0181 TGAGATTTCG -AAAAACCAG CCAGCAATTC CACCATCTAG GCCAATTGAG CCAATATCTG 
0241 AGGTGCCGTT TGTGGAACCG GCCTTTGAGA AAAAATACTC TAGGACCCGT GGATTTAGCA 
0301 AGGAATTGTC CACACACAGG GATAATGAGA ATGAATATAT CGAGAGCACA GATGAGGTGT 
0361 CTCAGATGTT GAGCTTTACT AGCTATACGG ATGAATATGA TAGGGCAGAA CCACTCATTA 
0421 CCAAAACGCA AAAGTTTTAT AAAAAGAGAT CCCCCTTGAT TCCCAAATAC GATTCCGAGG 
0481 ATTCATATGT GGTCCCTAAG GAAACC 
 Assemble Data

12866R-1.IR_full       1   TCGGCACAGTTTCAACGGATATCCTGAATGGGCGCACATCATTCTTGTCCCTTAGTCCAG 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
12866R-1.in silico     1   TCGGCACAGTTTCAACGGATATCCTGAATGGGCGCACATCATTCTTGTCCCTTAGT-CAG 60


12866R-1.IR_full       61  TCCTCACGGGAGTGAAGTGGATTTGCCTNCTTCGTTCTACGAAAGCTTTAATCCAACTTT 120
                           | ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
12866R-1.in silico     61  T-CTCACGGGAGTGAAGTGGATTTGC---CTTCGTTCTACGAAAGCTTTAATCCAACTTT 120


12866R-1.IR_full       121 TCTTCCCAAGCTGCCTATCAGAAGATTTCCCCATATGCTTGTGGGGGCATCAAATGAGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12866R-1.in silico     121 TCTTCCCAAGCTGCCTATCAGAAGATTTCCCCATATGCTTGTGGGGGCATCAAATGAGCC 180


12866R-1.IR_full       181 TGAGATTTCGNAAAAACCAGCCAGCAATTCCACCATCTAGGCCAATTGAGCCAATATCTG 240
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
12866R-1.in silico     181 TGAGATTTCG-AAAAACCAGCCAGCAATTCCACCATCTAGGCCAATTGAGCCAATATCTG 240


12866R-1.IR_full       241 AGGTGCCGTTTGTGGAACCGGCCTTTGAGAAAAAATACTCTAGGACCCGTGGATTTAGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12866R-1.in silico     241 AGGTGCCGTTTGTGGAACCGGCCTTTGAGAAAAAATACTCTAGGACCCGTGGATTTAGCA 300


12866R-1.IR_full       301 AGGAATTGTCCACACACAGGGATAATGAGAATGAATATGTCGAGAGCACAGATGAGGTGT 360
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
12866R-1.in silico     301 AGGAATTGTCCACACACAGGGATAATGAGAATGAATATATCGAGAGCACAGATGAGGTGT 360


12866R-1.IR_full       361 CTCAGATGTTGAGCTTTACTAGCTATACGGATGAATATGATAGGGCAGAACCACTCATTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12866R-1.in silico     361 CTCAGATGTTGAGCTTTACTAGCTATACGGATGAATATGATAGGGCAGAACCACTCATTA 420


12866R-1.IR_full       421 CCAAAACGCAAAAGTTTTATAAAAAGAGATCCCCCTTGATTCCCAAATACGATTCCGAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12866R-1.in silico     421 CCAAAACGCAAAAGTTTTATAAAAAGAGATCCCCCTTGATTCCCAAATACGATTCCGAGG 480


12866R-1.IR_full       481 ATTCATATGTGGTCCCTAAGGAAACC 506
                           ||||||||||||||||||||||||||
12866R-1.in silico     481 ATTCATATGTGGTCCCTAAGGAAACC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137136.1  CG12866-RA (CG12866), mRNA 
0   NM_142350.1  CG11896-RA (CG11896), mRNA 
0   23  NM_169134.1  CG31556-RA (CG31556), mRNA 
0   NM_080327.2  CG3665-RA, transcript variant A (Fas2), mRNA 
0   NM_165551.2  CG30496-RA (CG30496), mRNA 
0   NM_135091.2  CG31989-RA (Cap-D3), mRNA 
0   NM_080121.2  CG7719-RA (gwl), mRNA 
0   NM_140971.1  CG5195-RA (CG5195), mRNA 
0   25  NM_135002.1  CG15635-RA (CG15635), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_139626.1  CG1273-RB (CG1273), mRNA 
0   NM_168863.1  CG32425-RC, transcript variant C (CG32425), mRNA 
0   NM_168861.1  CG32425-RE, transcript variant E (CG32425), mRNA 
0   NM_168860.1  CG32425-RA, transcript variant A (CG32425), mRNA 
0   NM_057507.3  CG8442-RA (Glu-RI), mRNA 
0   NM_176559.1  CG33096-RA, transcript variant A (CG33096), mRNA 
0   NM_176560.1  CG33096-RB, transcript variant B (CG33096), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_078879.2  CG10363-RA (TepIV), mRNA 
0   NM_136006.2  CG15145-RA (CG15145), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_135567.2  CG6187-RA (RluA-2), mRNA 
0   NM_142962.2  CG6164-RA (CG6164), mRNA 
0   13  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_138260.4  CG2199-RA, transcript variant A (CG2199), mRNA 
0   NM_167873.1  CG2199-RB, transcript variant B (CG2199), mRNA 
0   NM_167574.1  CG32556-RA, transcript variant A (CG32556), mRNA 
0   NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.