National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12576R-1 
 Symbol CG12576  Full Name CG12576 
 CG No CG12576  Old CG No CG12576 
 Synonyms anon-WO0140519.40, CG12576 
 Accession No (Link to NCBI) NM_134621.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tang HW, Spirohn K, Hu Y, Hao T, Kovács IA, Gao Y, Binari R, Yang-Zhou D, Wan KH, Bader JS, Balcha D, Bian W, Booth BW, Coté AG, de Rouck S, Desbuleux A, Goh KY, Kim DK, Knapp JJ, Lee WX, Lemmens I, Li C, Li M, Li R, Lim HJ, Liu Y, Luck K, Markey D, Pollis C, Rangarajan S, Rodiger J, Schlabach S, Shen Y, Sheykhkarimli D, TeeKing B, Roth FP, Tavernier J, Calderwood MA, Hill DE, Celniker SE, Vidal M, Perrimon N, Mohr SE.
Next-generation large-scale binary protein interaction network for Drosophila melanogaster.
Nat Commun (2023) 14(1) 2162 [ PubMed ID = 37061542 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTATTCCTGGGACTACTTGG 
 Primer Seq. 3'
aatctagaggtaccCGGGTATCGCATCCGGAATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTACTTCCT GGGACTACTT GGCTACTGGA TCTACTGGAC GCGCTGCAGC TTCCGCGTTG 
0061 TGCCTACGGA CGAGCTGCGC GGCAAGATCA ACACCTGGCT GCAGAGGATC GACGACTGGC 
0121 GCCACCGCAG TCCCAGCATG TTCTGCTTGG CCAGCAGCGG TTGCTTGGGC ACCCTCGCAG 
0181 TGCTCGGTCA CCTTATATCC GGATCAACGC TGGTACTGAC CATCCTGGTC GTCTCCGCAC 
0241 TAGTCTCCAC CAAGTACACC TTCAAGCTGC TGAAGATCGA GCACAGGGAC TTTCAGTGGT 
0301 CGGAGAAGCT GAACTACAAC AACTTGGAAG CCGAGGCAGA GGATGAGTTC CTGCCGGACG 
0361 TGAACGAGTC GAATCTGTTT GTGTTGGAGC GGGCCAGCGA TGTGGCCACC ATAAGTTCGC 
0421 CCACCGATGC GAATGATGAG GACGATGACG ATCGCAGCGA CGACGTACCG TCGGAGCTCC 
0481 TCATTCCGGA TGCGATACCC G 
 in silico PCR Fragment
0001 GCTA-TTCCT GGGACTACTT GGCTACTGGA TCTACTGGAC GCGCTGCAGC TTCCGCGTTG 
0061 TGCCTACGGA CGAGCTGCGC GGCAAGATCA ACACCTGGCT GCAGAGGATC GACGACTGGC 
0121 GCCACCGCAG TCCCAGCATG TTCTGCTTGG CCAGCAGCGG TTGCTTGGGC ACCCTCGCAG 
0181 TGCTCGGTCA CCTTATATCC GGATCAACGC TGGTACTGAC CATCCTGGTC GTCTCCGCAC 
0241 TAGTCTCCAC CAAGTACACC TTCAAGCTGC TGAAGATCGA GCACAGGGAC TTTCAGTGGT 
0301 CGGAGAAGCT GAACTACAAC AACTTGGAAG CCGAGGCAGA GGATGAGTTC CTGCCGGACG 
0361 TGAACGAGTC GAATCTGTTT GTGTTGGAGC GGGCCAGCGA TGTGGCCACC ATAAGTTCGC 
0421 CCACCGATGC GAATGATGAG GACGATGACG ATCGCAGCGA CGACGTACCG TCGGAGCTCC 
0481 TCATTCCGGA TGCGATACCC G 
 Assemble Data

12576R-1.IR_full       1   GCTACTTCCTGGGACTACTTGGCTACTGGATCTACTGGACGCGCTGCAGCTTCCGCGTTG 60
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     1   GCTA-TTCCTGGGACTACTTGGCTACTGGATCTACTGGACGCGCTGCAGCTTCCGCGTTG 60


12576R-1.IR_full       61  TGCCTACGGACGAGCTGCGCGGCAAGATCAACACCTGGCTGCAGAGGATCGACGACTGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     61  TGCCTACGGACGAGCTGCGCGGCAAGATCAACACCTGGCTGCAGAGGATCGACGACTGGC 120


12576R-1.IR_full       121 GCCACCGCAGTCCCAGCATGTTCTGCTTGGCCAGCAGCGGTTGCTTGGGCACCCTCGCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     121 GCCACCGCAGTCCCAGCATGTTCTGCTTGGCCAGCAGCGGTTGCTTGGGCACCCTCGCAG 180


12576R-1.IR_full       181 TGCTCGGTCACCTTATATCCGGATCAACGCTGGTACTGACCATCCTGGTCGTCTCCGCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     181 TGCTCGGTCACCTTATATCCGGATCAACGCTGGTACTGACCATCCTGGTCGTCTCCGCAC 240


12576R-1.IR_full       241 TAGTCTCCACCAAGTACACCTTCAAGCTGCTGAAGATCGAGCACAGGGACTTTCAGTGGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     241 TAGTCTCCACCAAGTACACCTTCAAGCTGCTGAAGATCGAGCACAGGGACTTTCAGTGGT 300


12576R-1.IR_full       301 CGGAGAAGCTGAACTACAACAACTTGGAAGCCGAGGCAGAGGATGAGTTCCTGCCGGACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     301 CGGAGAAGCTGAACTACAACAACTTGGAAGCCGAGGCAGAGGATGAGTTCCTGCCGGACG 360


12576R-1.IR_full       361 TGAACGAGTCGAATCTGTTTGTGTTGGAGCGGGCCAGCGATGTGGCCACCATAAGTTCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     361 TGAACGAGTCGAATCTGTTTGTGTTGGAGCGGGCCAGCGATGTGGCCACCATAAGTTCGC 420


12576R-1.IR_full       421 CCACCGATGCGAATGATGAGGACGATGACGATCGCAGCGACGACGTACCGTCGGAGCTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12576R-1.in silico     421 CCACCGATGCGAATGATGAGGACGATGACGATCGCAGCGACGACGTACCGTCGGAGCTCC 480


12576R-1.IR_full       481 TCATTCCGGATGCGATACCCG 501
                           |||||||||||||||||||||
12576R-1.in silico     481 TCATTCCGGATGCGATACCCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134621.2  CG12576-RA, transcript variant A (CG12576), mRNA 
100   482  NM_167779.1  CG12576-RB, transcript variant B (CG12576), mRNA 
0.2   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   21  NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   21  NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   21  NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   21  NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_057785.3  CG5373-RA (Pi3K59F), mRNA 
0   NM_080152.2  CG5092-RA (Tor), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_139415.1  CG13924-RA (CG13924), mRNA 
0   NM_138197.2  CG12031-RA, transcript variant A (MED14), mRNA 
0   NM_135786.1  CG6108-RA (CG6108), mRNA 
0   NM_078688.2  CG14226-RA (dome), mRNA 
0   NM_170278.1  CG31082-RA (CG31082), mRNA 
0   NM_132431.2  CG1655-RA (sofe), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_135399.2  CG18405-RB, transcript variant B (Sema-1a), mRNA 
0   28  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   26  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   24  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   NM_078695.2  CG17060-RA (Rab10), mRNA 
0   NM_130518.2  CG3703-RA (CG3703), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_142583.2  CG4703-RA (Arc42), mRNA 
0   NM_140776.2  CG13699-RA (CG13699), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.