National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12530R-3 
 Symbol Cdc42  Full Name Cdc42 
 CG No CG12530  Old CG No CG12530 
 Synonyms DmCDC42, cdc42, Dcdc42, Dm Cdc42, DCdc42, CDC42, DCDC42, Cdc42Dm, D-CDC42, D-Cdc42, Dmcdc42, CG12530, Cdc42 
 Accession No (Link to NCBI) NM_078690.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rosa A, Vlassaks E, Pichaud F, Baum B.
Ect2/Pbl acts via Rho and polarity proteins to direct the assembly of an isotropic actomyosin cortex upon mitotic entry.
Dev. Cell (2015) 32(5) 604-16 [ PubMed ID = 25703349 ] [ RRC reference ]

Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCAAACCATCAAGTGCGTG 
 Primer Seq. 3'
aatctagaggtaccTTTTCAGGCCCTTCTGTGTCA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ATGCAAACCA TCAAGTGCGT GGTCGTCGGC GACGGAGCCG TGGTGTAAGA CATGCCTGCT 
0061 CATCTCGTAT ACAACCAACA AGTTCCCGTC GGAGTACGTG CCCACGGTGT TCGACAACTA 
0121 TGCGGTCACT GTGATGATCG GCGGTGAGCC CTACACACTG GGCCTGTTCG ATACGGCCGG 
0181 ACAGGGAGGA TTACGATCGG CTGCGTCCGC TCTCCTATCC GCAGACGGAT GTCTTCCTTG 
0241 TCTGCTTTTC GGTGGTCAGT CCCAGTTCCT TCGAGAACGT CAAGGAGAAG TGGGTGCCCG 
0301 AGATTACACA CCATTGCCAA AAGACGCCGT TCCTGCTGGT GGGCACACAG ATTGATTTGC 
0361 GCGACGAGAA CAGCACGCTG GAGAAGCTGG CCAAGAACAA GCAGAAGCTC CATCACCATG 
0421 GAGCAGGGCG AGAAGCTGGC CAAGGAGCTG AAGGCCGTCA AGTACGTGGA GTGCTCGGCC 
0481 TTGACACAGA AGGGCCTGAA AA 
 in silico PCR Fragment
0001 ATGCAAACCA TCAAGTGCGT GGTCGTCGGC GACGGAGCCG TGG-GTAAGA CATGCCTGCT 
0061 CATCTCGTAT ACAACCAACA AGTTCCCGTC GGAGTACGTG CCCACGGTGT TCGACAACTA 
0121 TGCGGTCACT GTGATGATCG GCGGTGAGCC CTACACACTG GGCCTGTTCG ATACGGCCGG 
0181 ACA-GGAGGA CTACGATCGG CTGCGTCCGC TCTCCTATCC GCAGACGGAT GTCTTCCTTG 
0241 TCTGCTTTTC GGTGGTCAGT CCCAGTTCCT TCGAGAACGT CAAGGAGAAG TGGGTGCCCG 
0301 AGATTACACA CCATTGCCAA AAGACGCCGT TCCTGCTGGT GGGCACACAG ATTGATTTGC 
0361 GCGACGAGAA CAGCACGCTG GAGAAGCTGG CCAAGAACAA GCAGAAGC-C CATCACCATG 
0421 GAGCAGGGCG AGAAGCTGGC CAAGGAGCTG AAGGCCGTCA AGTACGTGGA GTGCTCGGCC 
0481 TTGACACAGA AGGGCCTGAA AA 
 Assemble Data

12530R-3.IR_full       1   ATGCAAACCATCAAGTGCGTGGTCGTCGGCGACGGAGCCGTGGTGTAAGACATGCCTGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
12530R-3.in silico     1   ATGCAAACCATCAAGTGCGTGGTCGTCGGCGACGGAGCCGTGG-GTAAGACATGCCTGCT 60


12530R-3.IR_full       61  CATCTCGTATACAACCAACAAGTTCCCGTCGGAGTACGTGCCCACGGTGTTCGACAACTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     61  CATCTCGTATACAACCAACAAGTTCCCGTCGGAGTACGTGCCCACGGTGTTCGACAACTA 120


12530R-3.IR_full       121 TGCGGTCACTGTGATGATCGGCGGTGAGCCCTACACACTGGGCCTGTTCGATACGGCCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     121 TGCGGTCACTGTGATGATCGGCGGTGAGCCCTACACACTGGGCCTGTTCGATACGGCCGG 180


12530R-3.IR_full       181 ACAGGGAGGATTACGATCGGCTGCGTCCGCTCTCCTATCCGCAGACGGATGTCTTCCTTG 240
                           ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     181 ACA-GGAGGACTACGATCGGCTGCGTCCGCTCTCCTATCCGCAGACGGATGTCTTCCTTG 240


12530R-3.IR_full       241 TCTGCTTTTCGGTGGTCAGTCCCAGTTCCTTCGAGAACGTCAAGGAGAAGTGGGTGCCCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     241 TCTGCTTTTCGGTGGTCAGTCCCAGTTCCTTCGAGAACGTCAAGGAGAAGTGGGTGCCCG 300


12530R-3.IR_full       301 AGATTACACACCATTGCCAAAAGACGCCGTTCCTGCTGGTGGGCACACAGATTGATTTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     301 AGATTACACACCATTGCCAAAAGACGCCGTTCCTGCTGGTGGGCACACAGATTGATTTGC 360


12530R-3.IR_full       361 GCGACGAGAACAGCACGCTGGAGAAGCTGGCCAAGAACAAGCAGAAGCTCCATCACCATG 420
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
12530R-3.in silico     361 GCGACGAGAACAGCACGCTGGAGAAGCTGGCCAAGAACAAGCAGAAGC-CCATCACCATG 420


12530R-3.IR_full       421 GAGCAGGGCGAGAAGCTGGCCAAGGAGCTGAAGGCCGTCAAGTACGTGGAGTGCTCGGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12530R-3.in silico     421 GAGCAGGGCGAGAAGCTGGCCAAGGAGCTGAAGGCCGTCAAGTACGTGGAGTGCTCGGCC 480


12530R-3.IR_full       481 TTGACACAGAAGGGCCTGAAAA 502
                           ||||||||||||||||||||||
12530R-3.in silico     481 TTGACACAGAAGGGCCTGAAAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
100   481  NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
1.03   25  41  61  NM_139864.1  CG8556-RA (Rac2), mRNA 
0.2   10  NM_166986.2  CG2849-RA, transcript variant A (Rala), mRNA 
0.2   10  NM_080324.3  CG2849-RC, transcript variant C (Rala), mRNA 
0.2   10  NM_166985.2  CG2849-RB, transcript variant B (Rala), mRNA 
0   21  68  65  NM_057602.3  CG2248-RA (Rac1), mRNA 
0   12  NM_166139.2  CG8416-RD, transcript variant D (Rho1), mRNA 
0   12  NM_206127.1  CG8416-RG, transcript variant G (Rho1), mRNA 
0   12  NM_206129.1  CG8416-RE, transcript variant E (Rho1), mRNA 
0   12  NM_134309.1  CG8416-RC, transcript variant C (Rho1), mRNA 
0   12  NM_057750.3  CG8416-RA, transcript variant A (Rho1), mRNA 
0   12  NM_206128.1  CG8416-RF, transcript variant F (Rho1), mRNA 
0   12  NM_134308.2  CG8416-RB, transcript variant B (Rho1), mRNA 
0   11  12  NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
0   NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
0   NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
0   13  NM_133136.1  CG7874-RA (CG7874), mRNA 
0   32  33  NM_170343.1  CG5588-RA, transcript variant A (Mtl), mRNA 
0   32  33  NM_079809.2  CG5588-RB, transcript variant B (Mtl), mRNA 
0   32  33  NM_170344.1  CG5588-RC, transcript variant C (Mtl), mRNA 
0   NM_169419.1  CG18476-RA (CG18476), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_132195.2  CG1515-RA (l(1)G0155), mRNA 
0   NM_135797.2  CG6523-RA (CG6523), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.