National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12530R-2 
 Symbol Cdc42  Full Name Cdc42 
 CG No CG12530  Old CG No CG12530 
 Synonyms DmCDC42, cdc42, Dcdc42, Dm Cdc42, DCdc42, CDC42, DCDC42, Cdc42Dm, D-CDC42, D-Cdc42, Dmcdc42, CG12530, Cdc42 
 Accession No (Link to NCBI) NM_078690.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
Rotkopf S, Hamberg Y, Aigaki T, Snapper SB, Shilo BZ, Schejter ED.
The WASp-based actin polymerization machinery is required in somatic support cells for spermatid maturation and release.
Development (2011) 138(13) 2729-39 [ PubMed ID = 21652648 ] [ RRC reference ]

Rosa A, Vlassaks E, Pichaud F, Baum B.
Ect2/Pbl acts via Rho and polarity proteins to direct the assembly of an isotropic actomyosin cortex upon mitotic entry.
Dev. Cell (2015) 32(5) 604-16 [ PubMed ID = 25703349 ] [ RRC reference ]

Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Honjo K, Mauthner SE, Wang Y, Skene JHP, Tracey WD Jr.
Nociceptor-Enriched Genes Required for Normal Thermal Nociception.
Cell Rep (2016) 16(2) 295-303 [ PubMed ID = 27346357 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     1   ATGCAAACCATCAAGTGCGTGGTCGTCGGCGACGGAGCCGTGG-GTAAGACATGCCTGCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CATCTCGTATACAACCAACAAGTTCCCGTCGGAGTACGTGCCCACGGTGTTCGACAACTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCGGTCACTGTGATGATCGGCGGTGAGCCCTACACACTGGGCCTGTTCGATACGGCCGG 180

                           ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACA-GGAGGACTACGATCGGCTGCGTCCGCTCTCCTATCCGCAGACGGATGTCTTCCTTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCTGCTTTTCGGTGGTCAGTCCCAGTTCCTTCGAGAACGTCAAGGAGAAGTGGGTGCCCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGATTACACACCATTGCCAAAAGACGCCGTTCCTGCTGGTGGGCACACAGATTGATTTGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     361 GCGACGAGAACAGCACGCTGGAGAAGCTGGCCAAGAACAAGCAGAAGC-CCATCACCATG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGCAGGGCGAGAAGCTGGCCAAGGAGCTGAAGGCCGTCAAGTACGTGGAGTGCTCGGCC 480

12530R-2.IR_full       481 TTGACACAGAAGGGCCTGAAAA 502
                           |||||||||||||||||||||| silico     481 TTGACACAGAAGGGCCTGAAAA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_078690.2  CG12530-RA, transcript variant A (Cdc42), mRNA 
100   481  NM_167677.1  CG12530-RB, transcript variant B (Cdc42), mRNA 
1.03   25  41  61  NM_139864.1  CG8556-RA (Rac2), mRNA 
0.2   10  NM_166986.2  CG2849-RA, transcript variant A (Rala), mRNA 
0.2   10  NM_080324.3  CG2849-RC, transcript variant C (Rala), mRNA 
0.2   10  NM_166985.2  CG2849-RB, transcript variant B (Rala), mRNA 
0   21  68  65  NM_057602.3  CG2248-RA (Rac1), mRNA 
0   12  NM_166139.2  CG8416-RD, transcript variant D (Rho1), mRNA 
0   12  NM_206127.1  CG8416-RG, transcript variant G (Rho1), mRNA 
0   12  NM_206129.1  CG8416-RE, transcript variant E (Rho1), mRNA 
0   12  NM_134309.1  CG8416-RC, transcript variant C (Rho1), mRNA 
0   12  NM_057750.3  CG8416-RA, transcript variant A (Rho1), mRNA 
0   12  NM_206128.1  CG8416-RF, transcript variant F (Rho1), mRNA 
0   12  NM_134308.2  CG8416-RB, transcript variant B (Rho1), mRNA 
0   11  12  NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
0   NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
0   NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
0   13  NM_133136.1  CG7874-RA (CG7874), mRNA 
0   32  33  NM_170343.1  CG5588-RA, transcript variant A (Mtl), mRNA 
0   32  33  NM_079809.2  CG5588-RB, transcript variant B (Mtl), mRNA 
0   32  33  NM_170344.1  CG5588-RC, transcript variant C (Mtl), mRNA 
0   NM_169419.1  CG18476-RA (CG18476), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_132195.2  CG1515-RA (l(1)G0155), mRNA 
0   NM_135797.2  CG6523-RA (CG6523), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.