National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12497R-1 
 Symbol trol  Full Name terribly reduced optic lobes 
 CG No CG33950  Old CG No CG12497 
 Synonyms CG12497, CG7981, CT23996, pcan, GC7891, EG:BACR25B3.10, EG:BACR25B3.1, EG:BACR25B3.11, EG:BACR25B3.2, l(1)3Ac, zw-1, l(1)trol, zw1, l(1)zw1, l(1)zwl, ZW-1, troll, l(1)VA51, l(1)9-96, CG33675, CG33950, BcDNA:GM02481, anon-WO0153538.72, trol, terribly reduced optic lobes, perlecan, Perlecan 
 Accession No (Link to NCBI) NM_001031867.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGACATTGACGACGGCCTACT 
 Primer Seq. 3'
aatctagaggtaccGCAGGTTCTGGAACTGTACGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGACATTGAC GACGGCCTAC TGGACGATGT CGATGAGACA CTGAAGCCCA TGGAGACCAA 
0061 GTCCGAGGAG GAAGACTTGC CCACTGGCAA NCTGGTTCAG CCAGAGTGTC CATCGCGTTC 
0121 NCCGTTCCAT AAACCGTTTA TTTGGTTCCG ACGACAATCA GGAACGGGGA CGACGACAAC 
0181 AGCGTGANCG GTCGCAAAGG AATCGCGATG CGATTAATCG GCAAAAAGAA CTGCGCCGCA 
0241 GACAAAAGGA GGACCACAAC CGCTGGAAGC AAATGCGAAT GGAGCGACAA CTGGAGAAAC 
0301 AGCGCCTGGT CAAACGGACC AATCATGTTG TCTTCAACCG CGCCACCGAT CCTCGCAAGC 
0361 GGGCATCGGA CCTTTACGAC GAGAACGAGG CATCCGGCTA TCACGAGGAG GATACAACTC 
0421 TCTATCGTAC CTaCTTCGTC GTTAACGAAC CTTATGNCAA CGAATACAGA GATCGAGAAA 
0481 GCGTACAGTT CCAGANCCTG C 
 in silico PCR Fragment
0001 TGACATTGAC GACGGCCTAC TGGACGATGT CGATGAGACA CTGAAGCCCA TGGAGACCAA 
0061 GTCCGAGGAG GAAGACTTGC CCACTGGCAA -CTGGTTCAG CCAGAGTGTC CATCGCGTTC 
0121 GCCGTTCCAT AAACCGTTTA TTTGGTTCCG ACGACAATCA GGAACGGGGA CGACGACAAC 
0181 AGCGTGAGCG GTCGCAAAGG AATCGCGATG CGATTAATCG GCAAAAAGAA CTGCGCCGCA 
0241 GACAAAAGGA GGACCACAAC CGCTGGAAGC AAATGCGAAT GGAGCGACAA CTGGAGAAAC 
0301 AGCGCTTGGT CAAACGGACC AATCATGTTG TCTTCAACCG CGCCACCGAT CCTCGCAAGC 
0361 GGGCATCGGA CCTTTACGAC GAGAACGAGG CATCCGGCTA TCACGAGGAG GATACAACTC 
0421 TCTATCGTAC CTACTTCGTC GTTAACGAAC CTTATGACAA CGAATACAGA GATCGAGAAA 
0481 GCGTACAGTT CCAGAACCTG C 
 Assemble Data

12497R-1.IR_full       1   TGACATTGACGACGGCCTACTGGACGATGTCGATGAGACACTGAAGCCCATGGAGACCAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico     1   TGACATTGACGACGGCCTACTGGACGATGTCGATGAGACACTGAAGCCCATGGAGACCAA 60


12497R-1.IR_full       61  GTCCGAGGAGGAAGACTTGCCCACTGGCAANCTGGTTCAGCCAGAGTGTCCATCGCGTTC 120
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
12497R-1.in silico     61  GTCCGAGGAGGAAGACTTGCCCACTGGCAA-CTGGTTCAGCCAGAGTGTCCATCGCGTTC 120


12497R-1.IR_full        121 CCGTTCCATAAACCGTTTATTTGGTTCCGACGACAATCAGGAACGGGGACGACGACAAC 179
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico      121 CCGTTCCATAAACCGTTTATTTGGTTCCGACGACAATCAGGAACGGGGACGACGACAAC 179


12497R-1.IR_full       181 AGCGTGANCGGTCGCAAAGGAATCGCGATGCGATTAATCGGCAAAAAGAACTGCGCCGCA 239
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico     181 AGCGTGAGCGGTCGCAAAGGAATCGCGATGCGATTAATCGGCAAAAAGAACTGCGCCGCA 239


12497R-1.IR_full       241 GACAAAAGGAGGACCACAACCGCTGGAAGCAAATGCGAATGGAGCGACAACTGGAGAAAC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico     241 GACAAAAGGAGGACCACAACCGCTGGAAGCAAATGCGAATGGAGCGACAACTGGAGAAAC 299


12497R-1.IR_full       301 AGCGCCTGGTCAAACGGACCAATCATGTTGTCTTCAACCGCGCCACCGATCCTCGCAAGC 359
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico     301 AGCGCTTGGTCAAACGGACCAATCATGTTGTCTTCAACCGCGCCACCGATCCTCGCAAGC 359


12497R-1.IR_full       361 GGGCATCGGACCTTTACGACGAGAACGAGGCATCCGGCTATCACGAGGAGGATACAACTC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12497R-1.in silico     361 GGGCATCGGACCTTTACGACGAGAACGAGGCATCCGGCTATCACGAGGAGGATACAACTC 419


12497R-1.IR_full       421 TCTATCGTACCTACTTCGTCGTTAACGAACCTTATGNCAACGAATACAGAGATCGAGAAA 479
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
12497R-1.in silico     421 TCTATCGTACCTACTTCGTCGTTAACGAACCTTATGACAACGAATACAGAGATCGAGAAA 479


12497R-1.IR_full       481 GCGTACAGTTCCAGANCCTGC 500
                           ||||||||||||||| |||||
12497R-1.in silico     481 GCGTACAGTTCCAGAACCTGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_139733.2  CG5537-RA (CG5537), mRNA 
0   NM_135286.1  CG6739-RA (CG6739), mRNA 
0   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0   NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 
0   NM_206465.1  CG11992-RD, transcript variant D (Rel), mRNA 
0   NM_079331.2  CG11280-RA (trn), mRNA 
0   NM_142246.2  CG4225-RA (CG4225), mRNA 
0   NM_001038709.1  CG17964-RI, transcript variant I (pan), mRNA 
0   NM_001014685.1  CG17964-RH, transcript variant H (pan), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_079126.2  CG3616-RA (Cyp9c1), mRNA 
0   NM_132308.1  CG12106-RA (CG12106), mRNA 
0   NM_167787.1  CG17600-RB, transcript variant B (CG17600), mRNA 
0   NM_134625.2  CG17600-RA, transcript variant A (CG17600), mRNA 
0   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_135700.3  CG7061-RA, transcript variant A (rab3-GAP), mRNA 
0   NM_164989.1  CG7061-RB, transcript variant B (rab3-GAP), mRNA 
0   NM_142333.1  CG5220-RA (CG5220), mRNA 
0   NM_078529.3  CG18009-RD, transcript variant D (Trf2), mRNA 
0   NM_206654.1  CG18009-RA, transcript variant A (Trf2), mRNA 
0   NM_165991.1  CG4832-RC, transcript variant C (cnn), mRNA 
0   NM_001014523.1  CG4832-RD, transcript variant D (cnn), mRNA 
0   NM_165990.1  CG4832-RB, transcript variant B (cnn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.