National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12489R-2 
 Symbol Dnr1  Full Name Defense repressor 1 
 CG No CG12489  Old CG No CG12489 
 Synonyms CG12489, Dnr1 
 Accession No (Link to NCBI) NM_137836.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Guntermann S, Primrose DA, Foley E.
Dnr1-dependent regulation of the Drosophila immune deficiency signaling pathway.
Dev Comp Immunol (2008) 33(1) 127-34 [ PubMed ID = 18775745 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCGGACTATCTGCGCCAAAT 
 Primer Seq. 3'
aatctagaggtaccTGTCGAAGACATAGCGCTTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCGGACTAT CTGCGCCAAA TAGCCGTGGA GCACGGCAAG CTGGCCAAGC TGCAGATGAG 
0061 CCTCAAGACG GCCAAGTACT GGCTGCTCAA GTCCATCCAG GATCTCGAAG GCTACGGCGA 
0121 GGAGCTCTTT AGCGGCGTGA CCACCAACGA GAGTGCCACG CGCTGCGACA TTGCGGTGGG 
0181 CGCCCATGGC ATCACCGTCT GCCGGGGGGG CGAGAAACAG AGCATCCCCT TTGGCGCCAT 
0241 CGCTGCGGCC AAGTCGCTGC GTCGCACTTT CAAGTTGGAG TACGTGGATG ACCACAACGA 
0301 TCGCAAGGAG CTGGAGATCA AGCTGCCCAA GCAGCCGATC GCCGCGGGCC TGTACCGCTC 
0361 CATCACGGAG CGCCACGCCT TCTACGTGTG CGACAAGGTG CGCGGAGTGG TGACCAATCA 
0421 GTTTACCCGG GATCTCAAGG GCACCATCGC CTCCATGTTC ATGGAGAATA CGGAGCTgGG 
0481 CAAGCGCTAT GTCTTCGACA  
 in silico PCR Fragment
0001 GGCGGACTAT CTGCGCCAAA TAGCCGTGGA GCACGGCAAG CTGGCCAAGC TGCAGATGAG 
0061 CCTCAAGACG GCCAAGTACT GGCTGCTCAA GTCCATCCAG GATCTCGAAG GCTACGGCGA 
0121 GGAGCTCTTT AGCGGCGTGA CCACCAACGA GAGTGCCACG CGCTGCGACA TTGCGGTGGG 
0181 CGCCCATGGC ATCACCGTCT GCCGGGGGGG CGAGAAACAG AGCATCCCCT TTGGCGCCAT 
0241 CGCTGCGGCC AAGTCGCTGC GTCGCACTTT CAAGTTGGAG TACGTGGATG ACCACAACGA 
0301 TCGCAAGGAG CTGGAGATCA AGCTGCCCAA GCAGCCGATC GCCGCGGGCC TGTACCGCTC 
0361 CATCACGGAG CGCCACGCCT TCTACGTGTG CGACAAGGTG CGCGGAGTGG TGACCAATCA 
0421 GTTTACCCGG GATCTCAAGG GCACCATCGC CTCCATGTTC ATGGAGAATA CGGAGCTGGG 
0481 CAAGCGCTAT GTCTTCGACA  
 Assemble Data

12489R-2.IR_full       1   GGCGGACTATCTGCGCCAAATAGCCGTGGAGCACGGCAAGCTGGCCAAGCTGCAGATGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     1   GGCGGACTATCTGCGCCAAATAGCCGTGGAGCACGGCAAGCTGGCCAAGCTGCAGATGAG 60


12489R-2.IR_full       61  CCTCAAGACGGCCAAGTACTGGCTGCTCAAGTCCATCCAGGATCTCGAAGGCTACGGCGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     61  CCTCAAGACGGCCAAGTACTGGCTGCTCAAGTCCATCCAGGATCTCGAAGGCTACGGCGA 120


12489R-2.IR_full       121 GGAGCTCTTTAGCGGCGTGACCACCAACGAGAGTGCCACGCGCTGCGACATTGCGGTGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     121 GGAGCTCTTTAGCGGCGTGACCACCAACGAGAGTGCCACGCGCTGCGACATTGCGGTGGG 180


12489R-2.IR_full       181 CGCCCATGGCATCACCGTCTGCCGGGGGGGCGAGAAACAGAGCATCCCCTTTGGCGCCAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     181 CGCCCATGGCATCACCGTCTGCCGGGGGGGCGAGAAACAGAGCATCCCCTTTGGCGCCAT 240


12489R-2.IR_full       241 CGCTGCGGCCAAGTCGCTGCGTCGCACTTTCAAGTTGGAGTACGTGGATGACCACAACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     241 CGCTGCGGCCAAGTCGCTGCGTCGCACTTTCAAGTTGGAGTACGTGGATGACCACAACGA 300


12489R-2.IR_full       301 TCGCAAGGAGCTGGAGATCAAGCTGCCCAAGCAGCCGATCGCCGCGGGCCTGTACCGCTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     301 TCGCAAGGAGCTGGAGATCAAGCTGCCCAAGCAGCCGATCGCCGCGGGCCTGTACCGCTC 360


12489R-2.IR_full       361 CATCACGGAGCGCCACGCCTTCTACGTGTGCGACAAGGTGCGCGGAGTGGTGACCAATCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     361 CATCACGGAGCGCCACGCCTTCTACGTGTGCGACAAGGTGCGCGGAGTGGTGACCAATCA 420


12489R-2.IR_full       421 GTTTACCCGGGATCTCAAGGGCACCATCGCCTCCATGTTCATGGAGAATACGGAGCTGGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12489R-2.in silico     421 GTTTACCCGGGATCTCAAGGGCACCATCGCCTCCATGTTCATGGAGAATACGGAGCTGGG 480


12489R-2.IR_full       481 CAAGCGCTATGTCTTCGACA 500
                           ||||||||||||||||||||
12489R-2.in silico     481 CAAGCGCTATGTCTTCGACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137836.1  CG12489-RA (Dnr1), mRNA 
0   10  NM_132018.2  CG3149-RA (CG3149), mRNA 
0   NM_143006.1  CG13617-RA (CG13617), mRNA 
0   NM_165970.1  CG4062-RB, transcript variant B (Aats-val), mRNA 
0   NM_080099.2  CG4062-RA, transcript variant A (Aats-val), mRNA 
0   NM_140625.2  CG4818-RA (CG4818), mRNA 
0   NM_078656.3  CG9108-RA (RSG7), mRNA 
0   NM_132132.1  CG4557-RA (CG4557), mRNA 
0   NM_078563.2  CG18361-RA, transcript variant A (dsh), mRNA 
0   NM_167279.1  CG18361-RB, transcript variant B (dsh), mRNA 
0   NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   NM_132530.2  CG1847-RA, transcript variant A (CG1847), mRNA 
0   NM_167311.1  CG1847-RB, transcript variant B (CG1847), mRNA 
0   NM_140466.1  CG5295-RA (CG5295), mRNA 
0   NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
0   NM_132065.1  CG4660-RA (CG4660), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_143618.2  CG1774-RA (CG1774), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_137110.2  CG8617-RA (CG8617), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   10  NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_001043134.1  CG7368-RB (CG7368), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.