National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1245R-1 
 Symbol MED27  Full Name Mediator complex subunit 27 
 CG No CG1245  Old CG No CG1245 
 Synonyms Med27, Trap37, CRSP34, dCRSP34, dTRAP37, CG1245, MED27 
 Accession No (Link to NCBI) NM_141312.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, López-Varea A, de Celis JF.
Identification of genes affecting wing patterning through a loss-of-function mutagenesis screen and characterization of med15 function during wing development.
Genetics (2010) 185(2) 671-84 [ PubMed ID = 20233856 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAAATACGTGAGGTAGAGCA 
 Primer Seq. 3'
aatctagaggtaccGGAACACCTCGTAACGTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAAATACGT GAGGTAGAGC AGCTGATTAA TGGACTGCCG GTGCCACCAA CACCCTATTC 
0061 TCTCGGGAAC ACCGCCTACC TGGCGCAGGA AACTTCGCAG GATCGACAGG CTCTATACCC 
0121 TCAGCTGGTG AACAGCTACA AGTGGATGGA CAAGGTGCAC GACCACAGCT TCTTGGCCTT 
0181 CAACAATCTC AACCAGAACA CACTCAGGCG CTCCTACAAT TACTGCTCGC AGAAAGCGCC 
0241 AGCGACTGCC CTTCTCGTCC TTCAACAACG ATCCAGACCA CATAGATAAG CTCCTGAGTG 
0301 AGATCAACAC CCCTCCGCAT ACTTCGTACA GAATTTTTCG TCCCTTCGGC ACAAACGCTG 
0361 TCACCATCGT AACAATAAGT AACGTGATGA AGGCGGCTAT TGTCTTCAAA GGAGTGCTTA 
0421 TAGAGTGGGT TACGGTTAAG GGATTCGATG AGCCGCTGGA GCATGACGAC CTGTGGGCCG 
0481 AGTCACGTTA CGAGGTGTTC C 
 in silico PCR Fragment
0001 GCAAATACGT GAGGTAGAGC AGCTGATTAA TGGACTGCCG GTGCCACCAA CACCCTATTC 
0061 TCTCGGGAAC ACCGCCTACC TGGCGCAGGA AACTTCGCAG GATCGACAGG CTCTATACCC 
0121 TCAGCTGGTG AACAGCTACA AGTGGATGGA CAAGGTGCAC GACCACAGCT TCTTGGCCTT 
0181 CAACAATCTC AACCAGAACA CACTCAGGCG CTCCTACAAT TACTGCTCGC AG-AAGCGCC 
0241 AGCGACTGCC CTTCTCGTCC TTCAACAACG ATCCAGACCA CATAGATAAG CTCCTGAGTG 
0301 AGATCAACAC CCCTCCGCAT ACTTCGTACA GAATTTTTCG TCCCTTCGGC ACAAACGCTG 
0361 TCACCATCGT AACAATAAGT AACGTGATGA AGGCGGCTAT TGTCTTCAAA GGAGTGCTTA 
0421 TAGAGTGGGT TACGGTTAAG GGATTCGATG AGCCGCTGGA GCATGACGAC CTGTGGGCCG 
0481 AGTCACGTTA CGAGGTGTTC C 
 Assemble Data

1245R-1.IR_full       1   GCAAATACGTGAGGTAGAGCAGCTGATTAATGGACTGCCGGTGCCACCAACACCCTATTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     1   GCAAATACGTGAGGTAGAGCAGCTGATTAATGGACTGCCGGTGCCACCAACACCCTATTC 60


1245R-1.IR_full       61  TCTCGGGAACACCGCCTACCTGGCGCAGGAAACTTCGCAGGATCGACAGGCTCTATACCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     61  TCTCGGGAACACCGCCTACCTGGCGCAGGAAACTTCGCAGGATCGACAGGCTCTATACCC 120


1245R-1.IR_full       121 TCAGCTGGTGAACAGCTACAAGTGGATGGACAAGGTGCACGACCACAGCTTCTTGGCCTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     121 TCAGCTGGTGAACAGCTACAAGTGGATGGACAAGGTGCACGACCACAGCTTCTTGGCCTT 180


1245R-1.IR_full       181 CAACAATCTCAACCAGAACACACTCAGGCGCTCCTACAATTACTGCTCGCAGAAAGCGCC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
1245R-1.in silico     181 CAACAATCTCAACCAGAACACACTCAGGCGCTCCTACAATTACTGCTCGCAG-AAGCGCC 240


1245R-1.IR_full       241 AGCGACTGCCCTTCTCGTCCTTCAACAACGATCCAGACCACATAGATAAGCTCCTGAGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     241 AGCGACTGCCCTTCTCGTCCTTCAACAACGATCCAGACCACATAGATAAGCTCCTGAGTG 300


1245R-1.IR_full       301 AGATCAACACCCCTCCGCATACTTCGTACAGAATTTTTCGTCCCTTCGGCACAAACGCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     301 AGATCAACACCCCTCCGCATACTTCGTACAGAATTTTTCGTCCCTTCGGCACAAACGCTG 360


1245R-1.IR_full       361 TCACCATCGTAACAATAAGTAACGTGATGAAGGCGGCTATTGTCTTCAAAGGAGTGCTTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     361 TCACCATCGTAACAATAAGTAACGTGATGAAGGCGGCTATTGTCTTCAAAGGAGTGCTTA 420


1245R-1.IR_full       421 TAGAGTGGGTTACGGTTAAGGGATTCGATGAGCCGCTGGAGCATGACGACCTGTGGGCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1245R-1.in silico     421 TAGAGTGGGTTACGGTTAAGGGATTCGATGAGCCGCTGGAGCATGACGACCTGTGGGCCG 480


1245R-1.IR_full       481 AGTCACGTTACGAGGTGTTCC 501
                          |||||||||||||||||||||
1245R-1.in silico     481 AGTCACGTTACGAGGTGTTCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141312.2  CG1245-RA (MED27), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_170444.1  CG7816-RF, transcript variant F (CG7816), mRNA 
0   NM_170445.1  CG7816-RG, transcript variant G (CG7816), mRNA 
0   NM_170440.1  CG7816-RA, transcript variant A (CG7816), mRNA 
0   NM_170441.1  CG7816-RC, transcript variant C (CG7816), mRNA 
0   NM_170443.1  CG7816-RE, transcript variant E (CG7816), mRNA 
0   NM_170442.1  CG7816-RD, transcript variant D (CG7816), mRNA 
0   NM_132980.1  CG8915-RA (CG8915), mRNA 
0   NM_169745.1  CG5175-RB, transcript variant B (kuk), mRNA 
0   NM_142338.1  CG5175-RA, transcript variant A (kuk), mRNA 
0   NM_137386.2  CG18631-RA (CG18631), mRNA 
0   NM_143427.2  CG1458-RA (CG1458), mRNA 
0   NM_166568.1  CG3499-RB (CG3499), mRNA 
0   NM_132914.2  CG9723-RA (CG9723), mRNA 
0   NM_130703.2  CG16781-RA (CG16781), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_164857.1  CG3811-RA, transcript variant A (Oatp30B), mRNA 
0   NM_136636.3  CG13739-RA (CG13739), mRNA 
0   NM_057669.2  CG12399-RA (Mad), mRNA 
0   NM_205946.1  CG3811-RC, transcript variant C (Oatp30B), mRNA 
0   NM_135449.2  CG3811-RB, transcript variant B (Oatp30B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.