National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12399R-2 
 Symbol Mad  Full Name Mothers against dpp 
 CG No CG12399  Old CG No CG12399 
 Synonyms mad, pMad, p-Mad, pMAD, MAD, 2/23, l(2)K00237, apg, l(2)k00237, En(vvl), E(zen)2, CG12399, Mad, P-mad 
 Accession No (Link to NCBI) NM_057669.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jukam D, Xie B, Rister J, Terrell D, Charlton-Perkins M, Pistillo D, Gebelein B, Desplan C, Cook T.
Opposite feedbacks in the Hippo pathway for growth control and neural fate.
Science (2013) 342(6155) 1238016 [ PubMed ID = 23989952 ] [ RRC reference ]

Organista MF, De Celis JF.
The Spalt transcription factors regulate cell proliferation, survival and epithelial integrity downstream of the Decapentaplegic signalling pathway.
Biol Open (2013) 2(1) 37-48 [ PubMed ID = 23336075 ] [ RRC reference ]

Lu Y, Yao Y, Li Z.
Ectopic Dpp signaling promotes stem cell competition through EGFR signaling in the Drosophila testis.
Sci Rep (2019) 9(1) 6118 [ PubMed ID = 30992503 ] [ RRC reference ]

Boulanger A, Farge M, Ramanoudjame C, Wharton K, Dura JM.
Drosophila motor neuron retraction during metamorphosis is mediated by inputs from TGF-β/BMP signaling and orphan nuclear receptors.
PLoS ONE (2012) 7(7) e40255 [ PubMed ID = 22792255 ] [ RRC reference ]

Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, Bai G, Li Z.
Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis.
Dev. Biol. (2018) 439(1) 42-51 [ PubMed ID = 29679558 ] [ RRC reference ]

Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev. Biol. (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGTGGAATCGAACACAAGC 
 Primer Seq. 3'
aatctagaggtaccTGGTTGAACTGCAGCATCGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGTGGAAT CGAACACAAG CAGCGCGATG TCCACACTGG GCTCGCTATT CTCCTTCACA 
0061 TCGCCGGCGG TGAAGAAGCT GCTGGGCTGG AAACAGGGTG ACGAAGAGGA GAAGTGGGCG 
0121 GAGAAGGCCG TCGACAGTCT GGTGAAGAAG TTGAANGAAG CGCAAGGGCG CCATCGAGGA 
0181 TGCATGGAGC GTGCGCTCTC CTGTCCCGGT CAGCCCTCGA AGTGTGTCAC CATTCCATGC 
0241 TCGCTGGACG GACGATTACA GGTCTCCCAT CGCAAGGGTC TGCCGCATGT GATCTAGCTG 
0301 CCGCGTGTGG NGCTGGCCAG ATGCTGCAGT CGCACCACGA ACTGAAGCCA CTCGAGCTGT 
0361 GCCAGTATCC GTTGCAGCGC CAAGCAGAAG GAGGNGTGCA TCAATCCGTA TCACTATAAG 
0421 CGCGTGGAGA GTCCGgtGNT CCCGCCAGTA CTCGTTCCTC GCCACTCGGA ATTCGCGCCC 
0481 GGTCACTCGA TGCTGCAGTT CAACCA 
 in silico PCR Fragment
0001 GATGTGGAAT CGAACACAAG CAGCGCGATG TCCACACTGG GCTCGCTATT CTCCTTCACA 
0061 TCGCCGGCGG TGAAGAAGCT GCTGGGCTGG AAACAGGGTG ACGAAGAGGA GAAGTGGGCG 
0121 GAGAAGGCCG TCGACAGTCT GGTGAAGAAG TTGAA-GAAG CGCAAGGGCG CCATCGAGGA 
0181 -GC-TGGAGC GTGCGCTCTC CTGTCCCGGT CAGCCCTCGA AGTGTGTCAC CATTCCACGC 
0241 TCGCTGGACG GACGATTACA GGTCTCCCAT CGCAAGGGTC TGCCGCATGT GATCTA-CTG 
0301 CCGCGTGTGG CGCTGGCCAG AT-CTGCAGT CGCACCACGA ACTGAAGCCA CTCGAGCTGT 
0361 GCCAGTATCC GTT-CAGCGC CAAGCAGAAG GAGGTGTGCA TCAATCCGTA TCACTATAAG 
0421 CGCGTGGAGA GTCCGGTGCT CCCGCCAGTA CTCGTTCCTC GCCACTCGGA ATTCGCGCCC 
0481 GGTCACTCGA TGCTGCAGTT CAACCA 
 Assemble Data

12399R-2.IR_full       1   GATGTGGAATCGAACACAAGCAGCGCGATGTCCACACTGGGCTCGCTATTCTCCTTCACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12399R-2.in silico     1   GATGTGGAATCGAACACAAGCAGCGCGATGTCCACACTGGGCTCGCTATTCTCCTTCACA 60


12399R-2.IR_full       61  TCGCCGGCGGTGAAGAAGCTGCTGGGCTGGAAACAGGGTGACGAAGAGGAGAAGTGGGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12399R-2.in silico     61  TCGCCGGCGGTGAAGAAGCTGCTGGGCTGGAAACAGGGTGACGAAGAGGAGAAGTGGGCG 120


12399R-2.IR_full       121 GAGAAGGCCGTCGACAGTCTGGTGAAGAAGTTGAANGAAGCGCAAGGGCGCCATCGAGGA 180
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
12399R-2.in silico     121 GAGAAGGCCGTCGACAGTCTGGTGAAGAAGTTGAA-GAAGCGCAAGGGCGCCATCGAGGA 180


12399R-2.IR_full       181 TGCATGGAGCGTGCGCTCTCCTGTCCCGGTCAGCCCTCGAAGTGTGTCACCATTCCATGC 240
                            || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
12399R-2.in silico     181 -GC-TGGAGCGTGCGCTCTCCTGTCCCGGTCAGCCCTCGAAGTGTGTCACCATTCCACGC 240


12399R-2.IR_full       241 TCGCTGGACGGACGATTACAGGTCTCCCATCGCAAGGGTCTGCCGCATGTGATCTAGCTG 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
12399R-2.in silico     241 TCGCTGGACGGACGATTACAGGTCTCCCATCGCAAGGGTCTGCCGCATGTGATCTA-CTG 300


12399R-2.IR_full       301 CCGCGTGTGGNGCTGGCCAGATGCTGCAGTCGCACCACGAACTGAAGCCACTCGAGCTGT 360
                           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
12399R-2.in silico     301 CCGCGTGTGGCGCTGGCCAGAT-CTGCAGTCGCACCACGAACTGAAGCCACTCGAGCTGT 360


12399R-2.IR_full       361 GCCAGTATCCGTTGCAGCGCCAAGCAGAAGGAGGNGTGCATCAATCCGTATCACTATAAG 420
                           ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||
12399R-2.in silico     361 GCCAGTATCCGTT-CAGCGCCAAGCAGAAGGAGGTGTGCATCAATCCGTATCACTATAAG 420


12399R-2.IR_full       421 CGCGTGGAGAGTCCGGTGNTCCCGCCAGTACTCGTTCCTCGCCACTCGGAATTCGCGCCC 480
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
12399R-2.in silico     421 CGCGTGGAGAGTCCGGTGCTCCCGCCAGTACTCGTTCCTCGCCACTCGGAATTCGCGCCC 480


12399R-2.IR_full       481 GGTCACTCGATGCTGCAGTTCAACCA 506
                           ||||||||||||||||||||||||||
12399R-2.in silico     481 GGTCACTCGATGCTGCAGTTCAACCA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057669.2  CG12399-RA (Mad), mRNA 
0   29  43  NM_078524.2  CG2262-RA (Smox), mRNA 
0   NM_132260.2  CG12113-RA (l(1)G0095), mRNA 
0   NM_057659.2  CG9652-RA (DopR), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_143770.2  CG3845-RB, transcript variant B (l(2)01424), mRNA 
0   NM_001038854.1  CG3845-RC, transcript variant C (l(2)01424), mRNA 
0   NM_165961.1  CG3845-RA, transcript variant A (l(2)01424), mRNA 
0   NM_079987.2  CG1263-RA, transcript variant A (RpL8), mRNA 
0   NM_167955.1  CG1263-RB, transcript variant B (RpL8), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_206424.1  CG7448-RB, transcript variant B (CG7448), mRNA 
0   NM_141116.1  CG7448-RA, transcript variant A (CG7448), mRNA 
0   NM_057379.2  CG8355-RC, transcript variant C (sli), mRNA 
0   NM_057381.2  CG8355-RB, transcript variant B (sli), mRNA 
0   NM_057380.2  CG8355-RA, transcript variant A (sli), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_143402.2  CG1420-RA (CG1420), mRNA 
0   NM_166704.1  CG15792-RB, transcript variant B (zip), mRNA 
0   NM_001014553.1  CG15792-RC, transcript variant C (zip), mRNA 
0   NM_079136.2  CG15792-RA, transcript variant A (zip), mRNA 
0   NM_001014552.1  CG15792-RD, transcript variant D (zip), mRNA 
0   NM_137148.2  CG10202-RA (CG10202), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   NM_142557.1  CG7333-RA (CG7333), mRNA 
0   NM_079349.2  CG5185-RA (Tom), mRNA 
0   NM_143995.2  CG13631-RA (CG13631), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_136942.2  CG8545-RA (CG8545), mRNA 
0   NM_140935.2  CG17145-RA (CG17145), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.