National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12399R-1 
 Symbol Mad  Full Name Mothers against dpp 
 CG No CG12399  Old CG No CG12399 
 Synonyms mad, pMad, p-Mad, pMAD, MAD, 2/23, l(2)K00237, apg, l(2)k00237, En(vvl), E(zen)2, CG12399, Mad, P-mad 
 Accession No (Link to NCBI) NM_057669.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Lu Y, Yao Y, Li Z.
Ectopic Dpp signaling promotes stem cell competition through EGFR signaling in the Drosophila testis.
Sci Rep (2019) 9(1) 6118 [ PubMed ID = 30992503 ] [ RRC reference ]

Boulanger A, Farge M, Ramanoudjame C, Wharton K, Dura JM.
Drosophila motor neuron retraction during metamorphosis is mediated by inputs from TGF-β/BMP signaling and orphan nuclear receptors.
PLoS ONE (2012) 7(7) e40255 [ PubMed ID = 22792255 ] [ RRC reference ]

Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, Bai G, Li Z.
Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis.
Dev. Biol. (2018) 439(1) 42-51 [ PubMed ID = 29679558 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev. Biol. (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATGTGGAATCGAACACAAGCAGCGCGATGTCCACACTGGGCTCGCTATTCTCCTTCACA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGCCGGCGGTGAAGAAGCTGCTGGGCTGGAAACAGGGTGACGAAGAGGAGAAGTGGGCG 120

                           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     121 GAGAAGGCCGTCGACAGTCTGGTGAAGAAGTTGAA-GAAGCGCAAGGGCGCCATCGAGGA 180

                            || ||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     181 -GC-TGGAGCGTGCGCTCTCCTGTCCCGGTCAGCCCTCGAAGTGTGTCACCATTCCACGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     241 TCGCTGGACGGACGATTACAGGTCTCCCATCGCAAGGGTCTGCCGCATGTGATCTA-CTG 300

                           |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| silico     301 CCGCGTGTGGCGCTGGCCAGAT-CTGCAGTCGCACCACGAACTGAAGCCACTCGAGCTGT 360

                           ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| silico     361 GCCAGTATCCGTT-CAGCGCCAAGCAGAAGGAGGTGTGCATCAATCCGTATCACTATAAG 420

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     421 CGCGTGGAGAGTCCGGTGCTCCCGCCAGTACTCGTTCCTCGCCACTCGGAATTCGCGCCC 480

                           |||||||||||||||||||||||||| silico     481 GGTCACTCGATGCTGCAGTTCAACCA 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057669.2  CG12399-RA (Mad), mRNA 
0   29  43  NM_078524.2  CG2262-RA (Smox), mRNA 
0   NM_132260.2  CG12113-RA (l(1)G0095), mRNA 
0   NM_057659.2  CG9652-RA (DopR), mRNA 
0   NM_136046.2  CG15161-RA (CG15161), mRNA 
0   NM_143770.2  CG3845-RB, transcript variant B (l(2)01424), mRNA 
0   NM_001038854.1  CG3845-RC, transcript variant C (l(2)01424), mRNA 
0   NM_165961.1  CG3845-RA, transcript variant A (l(2)01424), mRNA 
0   NM_079987.2  CG1263-RA, transcript variant A (RpL8), mRNA 
0   NM_167955.1  CG1263-RB, transcript variant B (RpL8), mRNA 
0   NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_206424.1  CG7448-RB, transcript variant B (CG7448), mRNA 
0   NM_141116.1  CG7448-RA, transcript variant A (CG7448), mRNA 
0   NM_057379.2  CG8355-RC, transcript variant C (sli), mRNA 
0   NM_057381.2  CG8355-RB, transcript variant B (sli), mRNA 
0   NM_057380.2  CG8355-RA, transcript variant A (sli), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_143402.2  CG1420-RA (CG1420), mRNA 
0   NM_166704.1  CG15792-RB, transcript variant B (zip), mRNA 
0   NM_001014553.1  CG15792-RC, transcript variant C (zip), mRNA 
0   NM_079136.2  CG15792-RA, transcript variant A (zip), mRNA 
0   NM_001014552.1  CG15792-RD, transcript variant D (zip), mRNA 
0   NM_137148.2  CG10202-RA (CG10202), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   NM_142557.1  CG7333-RA (CG7333), mRNA 
0   NM_079349.2  CG5185-RA (Tom), mRNA 
0   NM_143995.2  CG13631-RA (CG13631), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_136942.2  CG8545-RA (CG8545), mRNA 
0   NM_140935.2  CG17145-RA (CG17145), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.