National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12370R-4 
 Symbol CG12370  Full Name CG12370 
 CG No CG12370  Old CG No CG12370 
 Synonyms unnamed, CG13156, anon-WO0170980.104, anon-WO0170980.103, CG12370 
 Accession No (Link to NCBI) NM_165907.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
King AN, Barber AF, Smith AE, Dreyer AP, Sitaraman D, Nitabach MN, Cavanaugh DJ, Sehgal A.
A Peptidergic Circuit Links the Circadian Clock to Locomotor Activity.
Curr Biol (2017) 27(13) 1915-1927.e5 [ PubMed ID = 28669757 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATTCAAGGGCGTGCACTACGACACCACAGACAATGCCACCCGCTTTTGCTTTCCAAACGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AACGTGGGATCACTATTCGGACTATGACCGCTGTCACCAGAACTCGGGCTCCATACCGGT 120

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     121 GGTGCCCGACTTCTCACCCAACGTCGAACTGCCGGCCATCATATA-TGCCGGCGGTTATT 180

                           |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     181 TCCTGA-GCTTCGCCACCTTGGTGGTGGCTCTCATCATATTCCTCAGCTTTAAAGATCTT 240

                           |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| silico     241 CGTTGCCTGCGAAACACCATTCATGCCAATTTGTTCCTCACCTAC-ATCACATCCGCACT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTCTGGATACTCACACTGTTCCTGCAAGTGATAACCACAGAGTCTAGTCAGGCTGGCTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CATAACGTTGGTAATCATGTTTCAGTACTTTTACCTAACCAACTTTTTCTGGATGTTTGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGAGGGCCTCTATCTGTACACGCTGGTGGTGCAAACATTCTCCAGTGATAACATTAGCTT 480

12370R-4.IR_full       481 TATTATCTACGCCCTCATCGGCT 503
                           ||||||||||||||||||||||| silico     481 TATTATCTACGCCCTCATCGGCT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165907.3  CG12370-RA (CG12370), mRNA 
0   46  NM_137116.2  CG8422-RA (CG8422), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_169429.3  CG14723-RA, transcript variant A (HisCl1), mRNA 
0   NM_141859.3  CG14723-RB, transcript variant B (HisCl1), mRNA 
0   NM_206474.1  CG14723-RC, transcript variant C (HisCl1), mRNA 
0   NM_134659.2  CG11490-RA (CG11490), mRNA 
0   NM_080118.2  CG2075-RA (aly), mRNA 
0   NM_142326.2  CG16941-RA (CG16941), mRNA 
0   NM_138131.2  CG9047-RA, transcript variant A (CG9047), mRNA 
0   NM_166693.1  CG9047-RB, transcript variant B (CG9047), mRNA 
0   NM_166694.1  CG9047-RC, transcript variant C (CG9047), mRNA 
0   NM_165179.1  CG31812-RA (CG31812), mRNA 
0   NM_132615.1  CG4395-RA (CG4395), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_136664.1  CG1863-RA, transcript variant A (CG1863), mRNA 
0   NM_206064.1  CG1863-RB, transcript variant B (CG1863), mRNA 
0   NM_136208.2  CG9317-RA, transcript variant A (CG9317), mRNA 
0   NM_165340.1  CG9317-RB, transcript variant B (CG9317), mRNA 
0   NM_132262.2  CG11265-RA, transcript variant A (CG11265), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_206659.1  CG11265-RC, transcript variant C (CG11265), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_168542.1  CG10171-RB, transcript variant B (CG10171), mRNA 
0   NM_140382.1  CG10171-RA, transcript variant A (CG10171), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_134748.2  CG5423-RA (robo3), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.