National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12370R-4 
 Symbol CG12370  Full Name CG12370 
 CG No CG12370  Old CG No CG12370 
 Synonyms unnamed, CG13156, anon-WO0170980.104, anon-WO0170980.103, CG12370 
 Accession No (Link to NCBI) NM_165907.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
King AN, Barber AF, Smith AE, Dreyer AP, Sitaraman D, Nitabach MN, Cavanaugh DJ, Sehgal A.
A Peptidergic Circuit Links the Circadian Clock to Locomotor Activity.
Curr. Biol. (2017) 27(13) 1915-1927.e5 [ PubMed ID = 28669757 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTCAAGGGCGTGCACTACGA 
 Primer Seq. 3'
aatctagaggtaccAGCCGATGAGGGCGTAGATAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTCAAGGGC GTGCACTACG ACACCACAGA CAATGCCACC CGCTTTTGCT TTCCAAACGG 
0061 AACGTGGGAT CACTATTCGG ACTATGACCG CTGTCACCAG AACTCGGGCT CCATACCGGT 
0121 GGTGCCCGAC TTCTCACCCA ACGTCGAACT GCCGGCCATC ATATACTGCC GGCGGTTATT 
0181 TCCTGACGCT TCGCCACCTT GGTGGTVGCT CTCATCATAT TCCTCAGCTT TAAAGATCTT 
0241 CGTTGCCTGC GAAACACCAT TCATGCCAAT CTGTTCCTCA CCTACGATCA CATCCGCACT 
0301 CCTCTGGATA CTCACACTGT TCCTGCAAGT GATAACCACA GAGTCTAGTC AGGCTGGCTG 
0361 CATAACGTTG GTAATCATGT TTCAGTACTT TTACCTAACC AACTTTTTCT GGATGTTTGT 
0421 GGAGGGCCTC TATCTGTACA CGCTGGTGGT GCAAACATTC TCCAGTGATA ACATTAGCTT 
0481 TATTATCTAC GCCCTCATCG GCT 
 in silico PCR Fragment
0001 ATTCAAGGGC GTGCACTACG ACACCACAGA CAATGCCACC CGCTTTTGCT TTCCAAACGG 
0061 AACGTGGGAT CACTATTCGG ACTATGACCG CTGTCACCAG AACTCGGGCT CCATACCGGT 
0121 GGTGCCCGAC TTCTCACCCA ACGTCGAACT GCCGGCCATC ATATA-TGCC GGCGGTTATT 
0181 TCCTGA-GCT TCGCCACCTT GGTGGTGGCT CTCATCATAT TCCTCAGCTT TAAAGATCTT 
0241 CGTTGCCTGC GAAACACCAT TCATGCCAAT TTGTTCCTCA CCTAC-ATCA CATCCGCACT 
0301 CCTCTGGATA CTCACACTGT TCCTGCAAGT GATAACCACA GAGTCTAGTC AGGCTGGCTG 
0361 CATAACGTTG GTAATCATGT TTCAGTACTT TTACCTAACC AACTTTTTCT GGATGTTTGT 
0421 GGAGGGCCTC TATCTGTACA CGCTGGTGGT GCAAACATTC TCCAGTGATA ACATTAGCTT 
0481 TATTATCTAC GCCCTCATCG GCT 
 Assemble Data

12370R-4.IR_full       1   ATTCAAGGGCGTGCACTACGACACCACAGACAATGCCACCCGCTTTTGCTTTCCAAACGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12370R-4.in silico     1   ATTCAAGGGCGTGCACTACGACACCACAGACAATGCCACCCGCTTTTGCTTTCCAAACGG 60


12370R-4.IR_full       61  AACGTGGGATCACTATTCGGACTATGACCGCTGTCACCAGAACTCGGGCTCCATACCGGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12370R-4.in silico     61  AACGTGGGATCACTATTCGGACTATGACCGCTGTCACCAGAACTCGGGCTCCATACCGGT 120


12370R-4.IR_full       121 GGTGCCCGACTTCTCACCCAACGTCGAACTGCCGGCCATCATATACTGCCGGCGGTTATT 180
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
12370R-4.in silico     121 GGTGCCCGACTTCTCACCCAACGTCGAACTGCCGGCCATCATATA-TGCCGGCGGTTATT 180


12370R-4.IR_full       181 TCCTGACGCTTCGCCACCTTGGTGGTVGCTCTCATCATATTCCTCAGCTTTAAAGATCTT 240
                           |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||
12370R-4.in silico     181 TCCTGA-GCTTCGCCACCTTGGTGGTGGCTCTCATCATATTCCTCAGCTTTAAAGATCTT 240


12370R-4.IR_full       241 CGTTGCCTGCGAAACACCATTCATGCCAATCTGTTCCTCACCTACGATCACATCCGCACT 300
                           |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
12370R-4.in silico     241 CGTTGCCTGCGAAACACCATTCATGCCAATTTGTTCCTCACCTAC-ATCACATCCGCACT 300


12370R-4.IR_full       301 CCTCTGGATACTCACACTGTTCCTGCAAGTGATAACCACAGAGTCTAGTCAGGCTGGCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12370R-4.in silico     301 CCTCTGGATACTCACACTGTTCCTGCAAGTGATAACCACAGAGTCTAGTCAGGCTGGCTG 360


12370R-4.IR_full       361 CATAACGTTGGTAATCATGTTTCAGTACTTTTACCTAACCAACTTTTTCTGGATGTTTGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12370R-4.in silico     361 CATAACGTTGGTAATCATGTTTCAGTACTTTTACCTAACCAACTTTTTCTGGATGTTTGT 420


12370R-4.IR_full       421 GGAGGGCCTCTATCTGTACACGCTGGTGGTGCAAACATTCTCCAGTGATAACATTAGCTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12370R-4.in silico     421 GGAGGGCCTCTATCTGTACACGCTGGTGGTGCAAACATTCTCCAGTGATAACATTAGCTT 480


12370R-4.IR_full       481 TATTATCTACGCCCTCATCGGCT 503
                           |||||||||||||||||||||||
12370R-4.in silico     481 TATTATCTACGCCCTCATCGGCT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165907.3  CG12370-RA (CG12370), mRNA 
0   46  NM_137116.2  CG8422-RA (CG8422), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_169429.3  CG14723-RA, transcript variant A (HisCl1), mRNA 
0   NM_141859.3  CG14723-RB, transcript variant B (HisCl1), mRNA 
0   NM_206474.1  CG14723-RC, transcript variant C (HisCl1), mRNA 
0   NM_134659.2  CG11490-RA (CG11490), mRNA 
0   NM_080118.2  CG2075-RA (aly), mRNA 
0   NM_142326.2  CG16941-RA (CG16941), mRNA 
0   NM_138131.2  CG9047-RA, transcript variant A (CG9047), mRNA 
0   NM_166693.1  CG9047-RB, transcript variant B (CG9047), mRNA 
0   NM_166694.1  CG9047-RC, transcript variant C (CG9047), mRNA 
0   NM_165179.1  CG31812-RA (CG31812), mRNA 
0   NM_132615.1  CG4395-RA (CG4395), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_136664.1  CG1863-RA, transcript variant A (CG1863), mRNA 
0   NM_206064.1  CG1863-RB, transcript variant B (CG1863), mRNA 
0   NM_136208.2  CG9317-RA, transcript variant A (CG9317), mRNA 
0   NM_165340.1  CG9317-RB, transcript variant B (CG9317), mRNA 
0   NM_132262.2  CG11265-RA, transcript variant A (CG11265), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_206659.1  CG11265-RC, transcript variant C (CG11265), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_168542.1  CG10171-RB, transcript variant B (CG10171), mRNA 
0   NM_140382.1  CG10171-RA, transcript variant A (CG10171), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_134748.2  CG5423-RA (robo3), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
+  
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.