National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12366R-2 
 Symbol O-fut1  Full Name O-fucosyltransferase 1 
 CG No CG12366  Old CG No CG12366 
 Synonyms Ofut1, OFUT1, nti, CG12366, 4R6, ntc, AAF58290.1, O-FUT1, l(2)SH2260, O-fut1, l(2)SH2 2260, O-fut 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTGAAGTGGAGCCCCTGAA 
 Primer Seq. 3'
aatctagaggtaccCTCTCACCCAATCGATACCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

12366R-2.IR full       1   -TTTGAAGTGGAGCCCCTGAAGGAATACCATCGCGTCATCACCATGGCAGATTTCATGTG 60
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-2.in silico     1   TTTTGAAGTGGAGCCCCTGAAGGAATACCATCGCGTCATCACCATGGCAGATTTCATGTG 60


12366R-2.IR full       61  GCACCTGGCCGACGACATTTGGCCAGAATCGGAGCGAGTGTCATTTTGCTACAAGGAACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-2.in silico     61  GCACCTGGCCGACGACATTTGGCCAGAATCGGAGCGAGTGTCATTTTGCTACAAGGAACG 120


12366R-2.IR full       121 ATATAGCCTTCAGCAGGAGAAGAACGATCCAGACAAGCCCAATTGCCACGCCAAGGATGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-2.in silico     121 ATATAGCCTTCAGCAGGAGAAGAACGATCCAGACAAGCCCAATTGCCACGCCAAGGATGG 180


12366R-2.IR full       181 CAATCCTTTTGGTCCCTTTTGGNNAACTTTTCACATAGACTTTGTGCGGTCAGAGTTCTA 240
                           ||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||
12366R-2.in silico     181 CAATCCTTTTGGTCCCTTTTGGGACACTTTTCACATAGACTTTGTGCGGTCAGAGTTCTA 240


12366R-2.IR full       241 TGCGCCACTTCATTTTGATGTGCATCATAGCAACGAGGCTGCCAAGTGGCCGACCAAATA 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
12366R-2.in silico     241 TGCGCCACTTCATTTTGATGTGCATCATAGCAACGAGGCTGCCAAGTGGCAGACCAAATA 300


12366R-2.IR full       301 TCCTGCAGAATCATATCCCGTACTCGCGTTCACCGGAGCTCCGGCTAGTTTTCCTGTTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-2.in silico     301 TCCTGCAGAATCATATCCCGTACTCGCGTTCACCGGAGCTCCGGCTAGTTTTCCTGTTCA 360


12366R-2.IR full       361 GCTAGAGAAACTGCAAGCTGCAGCCCTACTTGCAGTGGAGTCAACGGTATAGGGAAGCAT 420
                           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
12366R-2.in silico     361 GCTAGAGAA-CTGCAAGCTGCAGCGCTACTTGCAGTGGAGTCAACGGTATAGGGAAGCAT 420


12366R-2.IR full       421 CTAAGGATTTCATCCGAGAGCAGTTGCCTCGGGGTGCCTTTTTGGGCATTCATCTGCGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-2.in silico     421 CTAAGGATTTCATCCGAGAGCAGTTGCCTCGGGGTGCCTTTTTGGGCATTCATCTGCGCA 480


12366R-2.IR full       481 ACGGTATCGATTGGGTGAGAG 501
                           |||||||||||||||||||||
12366R-2.in silico     481 ACGGTATCGATTGGGTGAGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137087.2  O-fucosyltransferase 1 CG12366-RA (O-fut1), mRNA 
NM_167520.2  hangover CG32575-RB, transcript variant B (hang), mRNA 
NM_167521.2  hangover CG32575-RA, transcript variant A (hang), mRNA 
NM_143321.2  CG5590-RA (CG5590), mRNA 
NM_132590.1  CG2540-RA (CG2540), mRNA 
NM_143601.2  CG12114-RA (CG12114), mRNA 
NM_166015.1  short stop CG18076-RG, transcript variant G (shot), mRNA 
NM_166016.1  short stop CG18076-RB, transcript variant B (shot), mRNA 
NM_166017.1  short stop CG18076-RE, transcript variant E (shot), mRNA 
NM_079009.2  short stop CG18076-RA, transcript variant A (shot), mRNA 
NM_166018.1  short stop CG18076-RC, transcript variant C (shot), mRNA 
NM_166019.1  short stop CG18076-RH, transcript variant H (shot), mRNA 
NM_080047.2  kohtalo CG8491-RA (kto), mRNA 
NM_136755.2  CG16728-RA (CG16728), mRNA 
NM_133130.2  CG14193-RA (CG14193), mRNA 
NM_166790.2  bent CG32019-RA, transcript variant A (bt), mRNA 
NM_205877.1  bent CG32019-RD, transcript variant D (bt), mRNA 
NM_205876.1  bent CG32019-RC, transcript variant C (bt), mRNA 
NM_135607.2  CG6495-RA (CG6495), mRNA 
NM_205875.1  bent CG32019-RE, transcript variant E (bt), mRNA 
NM_078879.2  Thiolester containing protein IV CG10363-RA (TepIV), mRNA 
NM_130731.2  Vap-33-1 CG5014-RB, transcript variant B (Vap-33-1), mRNA 
NM_206625.1  Vap-33-1 CG5014-RA, transcript variant A (Vap-33-1), mRNA 
NM_206623.1  Vap-33-1 CG5014-RD, transcript variant D (Vap-33-1), mRNA 
NM_206624.1  Vap-33-1 CG5014-RC, transcript variant C (Vap-33-1), mRNA 
NM_058006.3  Hsp70/Hsp90 organizing protein homolog CG2720-RA (Hop), mRNA 
NM_057551.3  roundabout CG13521-RA, transcript variant A (robo), mRNA 
NM_166543.1  roundabout CG13521-RB, transcript variant B (robo), mRNA 
NM_170208.1  CG31103-RA (CG31103), mRNA 
NM_132895.2  TH1 CG9984-RA (TH1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.