National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12366R-1 
 Symbol O-fut1  Full Name O-fucosyltransferase 1 
 CG No CG12366  Old CG No CG12366 
 Synonyms Ofut1, OFUT1, nti, CG12366, 4R6, ntc, AAF58290.1, O-FUT1, l(2)SH2260, O-fut1, l(2)SH2 2260, O-fut 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTGAAGTGGAGCCCCTGAA 
 Primer Seq. 3'
aatctagaggtaccCTCTCACCCAATCGATACCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTGAAGTGG AGCCCCTGAA GGAATACCAT CGCGTCATCA CCATGGCAGA TTTCATGTGG 
0061 CACCTGGCCG ACGACATTTG GCCAGAATCG GAGCGAGTGT CATTTTGCTA CAAGGAACGA 
0121 TATAGCCTTC AGCAGGAGAA GAACGATCCA GACAAGCCCA ATTGCCACGC CAAGGATGGC 
0181 AATCCTTTTG GTCCCTTTTG GNNAACTTTT CACATAGACT TTGTGCGGTC AGAGTTCTAT 
0241 GCGCCACTTC ATTTTGATGT GCATCATAGC AACGAGGCTG CCAAGTGGCC GACCAAATAT 
0301 CCTGCAGAAT CATATCCCGT ACTCGCGTTC ACCGGAGCTC CGGCTAGTTT TCCTGTTCAG 
0361 CTAGAGAAAC TGCAAGCTGC AGCCCTACTT GCAGTGGAGT CAACGGTATA GGGAAGCATC 
0421 TAAGGATTTC ATCCGAGAGC AGTTGCCTCG GGGTGCCTTT TTGGGCATTC ATCTGCGCAA 
0481 CGGTATCGAT TGGGTGAGAG  
 in silico PCR Fragment
0001 ttttgaagtg gagcccctga aggaatacca tcgcgtcatc accatggcag atttcatgtg 
0061 gcacctggcc gacgacattt ggccagaatc ggagcgagtg tcattttgct acaaggaacg 
0121 atatagcctt cagcaggaga agaacgatcc agacaagccc aattgccacg ccaaggatgg 
0181 caatcctttt ggtccctttt gggacacttt tcacatagac tttgtgcggt cagagttcta 
0241 tgcgccactt cattttgatg tgcatcatag caacgaggct gccaagtggc agaccaaata 
0301 tcctgcagaa tcatatcccg tactcgcgtt caccggagct ccggctagtt ttcctgttca 
0361 gctagagaac tgcaagctgc agcgctactt gcagtggagt caacggtata gggaagcatc 
0421 taaggatttc atccgagagc agttgcctcg gggtgccttt ttgggcattc atctgcgcaa 
0481 cggtatcgat tgggtgagag  
 Assemble Data

12366R-1.IR full       1   -TTTGAAGTGGAGCCCCTGAAGGAATACCATCGCGTCATCACCATGGCAGATTTCATGTG 60
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-1.in silico     1   TTTTGAAGTGGAGCCCCTGAAGGAATACCATCGCGTCATCACCATGGCAGATTTCATGTG 60


12366R-1.IR full       61  GCACCTGGCCGACGACATTTGGCCAGAATCGGAGCGAGTGTCATTTTGCTACAAGGAACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-1.in silico     61  GCACCTGGCCGACGACATTTGGCCAGAATCGGAGCGAGTGTCATTTTGCTACAAGGAACG 120


12366R-1.IR full       121 ATATAGCCTTCAGCAGGAGAAGAACGATCCAGACAAGCCCAATTGCCACGCCAAGGATGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-1.in silico     121 ATATAGCCTTCAGCAGGAGAAGAACGATCCAGACAAGCCCAATTGCCACGCCAAGGATGG 180


12366R-1.IR full       181 CAATCCTTTTGGTCCCTTTTGGNNAACTTTTCACATAGACTTTGTGCGGTCAGAGTTCTA 240
                           ||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||
12366R-1.in silico     181 CAATCCTTTTGGTCCCTTTTGGGACACTTTTCACATAGACTTTGTGCGGTCAGAGTTCTA 240


12366R-1.IR full       241 TGCGCCACTTCATTTTGATGTGCATCATAGCAACGAGGCTGCCAAGTGGCCGACCAAATA 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
12366R-1.in silico     241 TGCGCCACTTCATTTTGATGTGCATCATAGCAACGAGGCTGCCAAGTGGCAGACCAAATA 300


12366R-1.IR full       301 TCCTGCAGAATCATATCCCGTACTCGCGTTCACCGGAGCTCCGGCTAGTTTTCCTGTTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-1.in silico     301 TCCTGCAGAATCATATCCCGTACTCGCGTTCACCGGAGCTCCGGCTAGTTTTCCTGTTCA 360


12366R-1.IR full       361 GCTAGAGAAACTGCAAGCTGCAGCCCTACTTGCAGTGGAGTCAACGGTATAGGGAAGCAT 420
                           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
12366R-1.in silico     361 GCTAGAGAA-CTGCAAGCTGCAGCGCTACTTGCAGTGGAGTCAACGGTATAGGGAAGCAT 420


12366R-1.IR full       421 CTAAGGATTTCATCCGAGAGCAGTTGCCTCGGGGTGCCTTTTTGGGCATTCATCTGCGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12366R-1.in silico     421 CTAAGGATTTCATCCGAGAGCAGTTGCCTCGGGGTGCCTTTTTGGGCATTCATCTGCGCA 480


12366R-1.IR full       481 ACGGTATCGATTGGGTGAGAG 501
                           |||||||||||||||||||||
12366R-1.in silico     481 ACGGTATCGATTGGGTGAGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137087.2  O-fucosyltransferase 1 CG12366-RA (O-fut1), mRNA 
NM_167520.2  hangover CG32575-RB, transcript variant B (hang), mRNA 
NM_167521.2  hangover CG32575-RA, transcript variant A (hang), mRNA 
NM_143321.2  CG5590-RA (CG5590), mRNA 
NM_132590.1  CG2540-RA (CG2540), mRNA 
NM_143601.2  CG12114-RA (CG12114), mRNA 
NM_166015.1  short stop CG18076-RG, transcript variant G (shot), mRNA 
NM_166016.1  short stop CG18076-RB, transcript variant B (shot), mRNA 
NM_166017.1  short stop CG18076-RE, transcript variant E (shot), mRNA 
NM_079009.2  short stop CG18076-RA, transcript variant A (shot), mRNA 
NM_166018.1  short stop CG18076-RC, transcript variant C (shot), mRNA 
NM_166019.1  short stop CG18076-RH, transcript variant H (shot), mRNA 
NM_080047.2  kohtalo CG8491-RA (kto), mRNA 
NM_136755.2  CG16728-RA (CG16728), mRNA 
NM_133130.2  CG14193-RA (CG14193), mRNA 
NM_166790.2  bent CG32019-RA, transcript variant A (bt), mRNA 
NM_205877.1  bent CG32019-RD, transcript variant D (bt), mRNA 
NM_205876.1  bent CG32019-RC, transcript variant C (bt), mRNA 
NM_135607.2  CG6495-RA (CG6495), mRNA 
NM_205875.1  bent CG32019-RE, transcript variant E (bt), mRNA 
NM_078879.2  Thiolester containing protein IV CG10363-RA (TepIV), mRNA 
NM_130731.2  Vap-33-1 CG5014-RB, transcript variant B (Vap-33-1), mRNA 
NM_206625.1  Vap-33-1 CG5014-RA, transcript variant A (Vap-33-1), mRNA 
NM_206623.1  Vap-33-1 CG5014-RD, transcript variant D (Vap-33-1), mRNA 
NM_206624.1  Vap-33-1 CG5014-RC, transcript variant C (Vap-33-1), mRNA 
NM_058006.3  Hsp70/Hsp90 organizing protein homolog CG2720-RA (Hop), mRNA 
NM_057551.3  roundabout CG13521-RA, transcript variant A (robo), mRNA 
NM_166543.1  roundabout CG13521-RB, transcript variant B (robo), mRNA 
NM_170208.1  CG31103-RA (CG31103), mRNA 
NM_132895.2  TH1 CG9984-RA (TH1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.