National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12359R-4 
 Symbol Ulp1  Full Name Ulp1 
 CG No CG12359  Old CG No CG12359 
 Synonyms CG12359, DmUlp1, BcDNA:GH02751, Ulp1 
 Accession No (Link to NCBI) NM_133134.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Smith M, Mallin DR, Simon JA, Courey AJ.
Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.
J. Biol. Chem. (2011) 286(13) 11391-400 [ PubMed ID = 21278366 ] [ RRC reference ]

Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) [ PubMed ID = 30333215 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGGACACCGATTTGTCCACAAATTCCGCATACGAATCCGCACTCCAAATCGCGAGCAAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGTCGGCAGCACGAGTAGTCGGTTCGGCAGTAGGACAGCGATTTTCGCCGTCGCCAGCA 120

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     121 GCTCACCCGAACGTGATTGAGCGCGTCGCGTC-TCATGTGGACTCACGCCGCAGCACGTT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCAAGTTGGGGTAATCCGTCAGTAGCGCCAAGAGGATCGGAAGAAGCAGCAGCCAACGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CACAGCAACACAACTCCTATGGGCGGAGAACCAAGGTCTCCCGACATCGCACTTATTGCC 300

                           |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACTGAACAGGCATTCGAGACATTGAACACTAATGCGTATTGTTCCCCGCCAGGGGATTC 360

                           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     361 ACGATTTACGTTCCCTAGCCAGAACTACTCGCCGCTGCTGCCGCGGTGTGTCCCAGTTCC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAATCAGCGTTACTCTCCAGATGGATCGCCAATACATCAACTCCATGAGCTGCAAAATTG 480

                           ||||||||||||||||||||||||| || | silico     481 TCCATTGATAGATTCGCCGATAAGACTGCG 510

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   491  NM_133134.2  CG12359-RA (Ulp1), mRNA 
0   NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_132272.1  CG11294-RA (CG11294), mRNA 
0   NM_001038928.1  CG33986-RA (CG33986), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_135258.1  CG4497-RA (CG4497), mRNA 
0   NM_135832.2  CG16889-RA (adat), mRNA 
0   NM_001043165.1  CG40294-RA (CG40294), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_134812.2  CG7074-RA (mio), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_167000.1  CG32778-RA (CG32778), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_079496.2  CG14637-RA (abs), mRNA 
0   15  22  NM_137050.1  CG6209-RA (CG6209), mRNA 
0   11  NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   11  NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0   NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0   NM_166894.1  CG11491-RA, transcript variant A (br), mRNA 
0   10  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   10  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_130616.2  CG4290-RA (CG4290), mRNA 
0   10  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   10  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0   NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0   NM_130571.1  CG14796-RA (CG14796), mRNA 
0   NM_136707.2  CG1371-RA (CG1371), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.