National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12359R-2 
 Symbol Ulp1  Full Name Ulp1 
 CG No CG12359  Old CG No CG12359 
 Synonyms CG12359, DmUlp1, BcDNA:GH02751, Ulp1 
 Accession No (Link to NCBI) NM_133134.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Smith M, Mallin DR, Simon JA, Courey AJ.
Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.
J. Biol. Chem. (2011) 286(13) 11391-400 [ PubMed ID = 21278366 ] [ RRC reference ]

Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) [ PubMed ID = 30333215 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGACACCGATTTGTCCACA 
 Primer Seq. 3'
aatctagaggtaccCGCAGTCTTATCGGCGAATCT 
 Predicted Fragment Size
509 
 IR fragment full Seq
0001 GAGGACACCG ATTTGTCCAC AAATTCCGCA TACGAATCCG CACTCCAAAT CGCGAGCAAT 
0061 GTGTCGGCAG CACGAGTAGT CGGTTCGGCA GTAGGACAGC GATTTTCGCC GTCGCCAGCA 
0121 GCTCACCCGA ACGTGATTGA GCGCGTCGCG TCTTCATGTG GACTCACGCC GCAGCACGTT 
0181 TCCAAGTTGG GGTAATCCGT CAGTAGCGCC AAGAGGATCG GAAGAAGCAG CAGCCAACGC 
0241 CACAGCAACA CAACTCCTAT GGGCGGAGAA CCAAGGTCTC CCGACATCGC ACTTATTGCC 
0301 AACTGAACAG GCTTTCGAGA CATTGAACAC TAATGCGTAT TGTTCCCCGC CAGGGGATTC 
0361 ACGATTTACG TTCCCTAGCC AGAACTACTC GCCGCNGCTG CCGCGGTGTG TCCCAGTTCC 
0421 GAATCAGCGT TACTCTCCAG ATGGATCGCC AATACATCAA CTCCATGAGC TGCAAAATTG 
0481 TCCATTGATA GATTCGCCGA TAAGANTGNG  
 in silico PCR Fragment
0001 GAGGACACCG ATTTGTCCAC AAATTCCGCA TACGAATCCG CACTCCAAAT CGCGAGCAAT 
0061 GTGTCGGCAG CACGAGTAGT CGGTTCGGCA GTAGGACAGC GATTTTCGCC GTCGCCAGCA 
0121 GCTCACCCGA ACGTGATTGA GCGCGTCGCG TC-TCATGTG GACTCACGCC GCAGCACGTT 
0181 TCCAAGTTGG GGTAATCCGT CAGTAGCGCC AAGAGGATCG GAAGAAGCAG CAGCCAACGC 
0241 CACAGCAACA CAACTCCTAT GGGCGGAGAA CCAAGGTCTC CCGACATCGC ACTTATTGCC 
0301 AACTGAACAG GCATTCGAGA CATTGAACAC TAATGCGTAT TGTTCCCCGC CAGGGGATTC 
0361 ACGATTTACG TTCCCTAGCC AGAACTACTC GCCGCTGCTG CCGCGGTGTG TCCCAGTTCC 
0421 GAATCAGCGT TACTCTCCAG ATGGATCGCC AATACATCAA CTCCATGAGC TGCAAAATTG 
0481 TCCATTGATA GATTCGCCGA TAAGACTGCG  
 Assemble Data

12359R-2.IR_full       1   GAGGACACCGATTTGTCCACAAATTCCGCATACGAATCCGCACTCCAAATCGCGAGCAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     1   GAGGACACCGATTTGTCCACAAATTCCGCATACGAATCCGCACTCCAAATCGCGAGCAAT 60


12359R-2.IR_full       61  GTGTCGGCAGCACGAGTAGTCGGTTCGGCAGTAGGACAGCGATTTTCGCCGTCGCCAGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     61  GTGTCGGCAGCACGAGTAGTCGGTTCGGCAGTAGGACAGCGATTTTCGCCGTCGCCAGCA 120


12359R-2.IR_full       121 GCTCACCCGAACGTGATTGAGCGCGTCGCGTCTTCATGTGGACTCACGCCGCAGCACGTT 180
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
12359R-2.in silico     121 GCTCACCCGAACGTGATTGAGCGCGTCGCGTC-TCATGTGGACTCACGCCGCAGCACGTT 180


12359R-2.IR_full       181 TCCAAGTTGGGGTAATCCGTCAGTAGCGCCAAGAGGATCGGAAGAAGCAGCAGCCAACGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     181 TCCAAGTTGGGGTAATCCGTCAGTAGCGCCAAGAGGATCGGAAGAAGCAGCAGCCAACGC 240


12359R-2.IR_full       241 CACAGCAACACAACTCCTATGGGCGGAGAACCAAGGTCTCCCGACATCGCACTTATTGCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     241 CACAGCAACACAACTCCTATGGGCGGAGAACCAAGGTCTCCCGACATCGCACTTATTGCC 300


12359R-2.IR_full       301 AACTGAACAGGCTTTCGAGACATTGAACACTAATGCGTATTGTTCCCCGCCAGGGGATTC 360
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     301 AACTGAACAGGCATTCGAGACATTGAACACTAATGCGTATTGTTCCCCGCCAGGGGATTC 360


12359R-2.IR_full       361 ACGATTTACGTTCCCTAGCCAGAACTACTCGCCGCNGCTGCCGCGGTGTGTCCCAGTTCC 420
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
12359R-2.in silico     361 ACGATTTACGTTCCCTAGCCAGAACTACTCGCCGCTGCTGCCGCGGTGTGTCCCAGTTCC 420


12359R-2.IR_full       421 GAATCAGCGTTACTCTCCAGATGGATCGCCAATACATCAACTCCATGAGCTGCAAAATTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12359R-2.in silico     421 GAATCAGCGTTACTCTCCAGATGGATCGCCAATACATCAACTCCATGAGCTGCAAAATTG 480


12359R-2.IR_full       481 TCCATTGATAGATTCGCCGATAAGANTGNG 510
                           ||||||||||||||||||||||||| || |
12359R-2.in silico     481 TCCATTGATAGATTCGCCGATAAGACTGCG 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   491  NM_133134.2  CG12359-RA (Ulp1), mRNA 
0   NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_132272.1  CG11294-RA (CG11294), mRNA 
0   NM_001038928.1  CG33986-RA (CG33986), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_135258.1  CG4497-RA (CG4497), mRNA 
0   NM_135832.2  CG16889-RA (adat), mRNA 
0   NM_001043165.1  CG40294-RA (CG40294), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_134812.2  CG7074-RA (mio), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_167000.1  CG32778-RA (CG32778), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_079496.2  CG14637-RA (abs), mRNA 
0   15  22  NM_137050.1  CG6209-RA (CG6209), mRNA 
0   11  NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   11  NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0   NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0   NM_166894.1  CG11491-RA, transcript variant A (br), mRNA 
0   10  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   10  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_130616.2  CG4290-RA (CG4290), mRNA 
0   10  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   10  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0   NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0   NM_130571.1  CG14796-RA (CG14796), mRNA 
0   NM_136707.2  CG1371-RA (CG1371), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
++  
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.