National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12311R-3 
 Symbol tw  Full Name Protein O-mannosyltransferase 2 
 CG No CG12311  Old CG No CG12311 
 Synonyms Pomt2, tw, CG12311, POMT2, DPOMT2, dPOMT2, EG:34F3.7, DmPOMT2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult pupal lehal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCGGGCCATCACCCTGATT 
 Primer Seq. 3'
aatctagaggtaccATCGCCTAGTCCCAACTCGCC 
 Predicted Fragment Size
498 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

12311R-3.IR full       1   TGCCGGGCCATCACCCTGATTGTCTGGCCCGTTCTCCTCTACATCCTGTTCTTCTACATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     1   TGCCGGGCCATCACCCTGATTGTCTGGCCCGTTCTCCTCTACATCCTGTTCTTCTACATT 60


12311R-3.IR full       61  CACCTGAGTGTCCTTAACCGCAGCGGCAACGGAGATGGGTTCTATAGTTCGGCCTTTCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     61  CACCTGAGTGTCCTTAACCGCAGCGGCAACGGAGATGGGTTCTATAGTTCGGCCTTTCAG 120


12311R-3.IR full       121 TCCAGGCTGATCGGCAACTCCCTATATAATGCCAGCATGCCCAGAGATGTCGCCTACGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     121 TCCAGGCTGATCGGCAACTCCCTATATAATGCCAGCATGCCCAGAGATGTCGCCTACGGA 180


12311R-3.IR full       181 TCGCTAGTGACAATCAAGAACCACAAGACGGGCGGAGGCTACCTGCACTCGCATCATCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     181 TCGCTAGTGACAATCAAGAACCACAAGACGGGCGGAGGCTACCTGCACTCGCATCATCAC 240


12311R-3.IR full       241 CTGTATCCCAAGGGATCTGGCGCTAGGCAGCAGCAGGTTACCACTTACACCCACAAGGAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     241 CTGTATCCCAAGGGATCTGGCGCTAGGCAGCAGCAGGTTACCACTTACACCCACAAGGAC 300


12311R-3.IR full       301 GAGAACAACAAGTGGCTAATCAGGCCGCACAACAAGCCGGGTCCACCAAAGGGCAAGGTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     301 GAGAACAACAAGTGGCTAATCAGGCCGCACAACAAGCCGGGTCCACCAAAGGGCAAGGTA 360


12311R-3.IR full       361 CAGATCCTCCGGCACGGGGACCTCGTCCGCCTGACTCACATGGCGACCAGGAGAAATCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     361 CAGATCCTCCGGCACGGGGACCTCGTCCGCCTGACTCACATGGCGACCAGGAGAAATCTG 420


12311R-3.IR full       421 CATTCCCACAACGAACCTGCACCCATGACCAAGAAGCATTTGCAGGTCACAGGCTATGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-3.in silico     421 CATTCCCACAACGAACCTGCACCCATGACCAAGAAGCATTTGCAGGTCACAGGCTATGGC 480


12311R-3.IR full       481 GAGTTGGGACTAGGCGATG 499
                           |||||||||||||||||| 
12311R-3.in silico     481 GAGTTGGGACTAGGCGAT- 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_130502.2  Protein O-mannosyltransferase 2 CG12311-RA (Pomt2), mRNA 
NM_143535.1  CG15534-RA (CG15534), mRNA 
NM_140777.1  CG7320-RA (CG7320), mRNA 
NM_136591.3  CG8213-RA (CG8213), mRNA 
NM_135492.3  CG4747-RA (CG4747), mRNA 
NM_139995.1  CG6511-RA (CG6511), mRNA 
NM_135438.2  CG13110-RA (CG13110), mRNA 
NM_139792.2  zero population growth CG10125-RA (zpg), mRNA 
NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
NM_206493.1  dpr9 CG33485-RA (dpr9), mRNA 
NM_057400.3  spineless CG6993-RA (ss), mRNA 
NM_134929.2  polypeptide GalNAc transferase 2 CG3254-RA (pgant2), mRNA 
NM_141050.1  CG12972-RA (CG12972), mRNA 
NM_142396.1  CG7397-RA (CG7397), mRNA 
NM_139962.3  monkey king protein CG7163-RB, transcript variant B (mkg-p), mRNA 
NM_176299.1  CG33057-RA, transcript variant A (CG33057), mRNA 
NM_168272.1  monkey king protein CG7163-RA, transcript variant A (mkg-p), mRNA 
NM_137169.3  charlatan CG11798-RA, transcript variant A (chn), mRNA 
NM_168671.2  CG32158-RA, transcript variant A (CG32158), mRNA 
NM_001043082.1  charlatan CG11798-RC, transcript variant C (chn), mRNA 
NM_206119.1  charlatan CG11798-RB, transcript variant B (chn), mRNA 
NM_138143.1  CG12851-RA (CG12851), mRNA 
NM_001043081.1  charlatan CG11798-RD, transcript variant D (chn), mRNA 
NM_137793.1  CG13502-RA, transcript variant A (CG13502), mRNA 
NM_166506.1  CG13502-RB, transcript variant B (CG13502), mRNA 
NM_138050.2  CG3363-RA (CG3363), mRNA 
NM_142461.2  CG14309-RA (CG14309), mRNA 
NM_080366.2  Elongation factor 2b CG2238-RA, transcript variant A (Ef2b), mRNA 
NM_165395.1  Elongation factor 2b CG2238-RC, transcript variant C (Ef2b), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.