National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12311R-1 
 Symbol tw  Full Name Protein O-mannosyltransferase 2 
 CG No CG12311  Old CG No CG12311 
 Synonyms Pomt2, tw, CG12311, POMT2, DPOMT2, dPOMT2, EG:34F3.7, DmPOMT2 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCGGGCCATCACCCTGATT   
 Primer Seq. 3'
aatctagaggtaccATCGCCTAGTCCCAACTCGCC   
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 TGCCGGGCCA TCACCCTGAT TGTCTGGCCC GTTCTCCTCT ACATCCTGTT CTTCTACATT 
0061 CACCTGAGTG TCCTTAACCG CAGCGGCAAC GGAGATGGGT TCTATAGTTC GGCCTTTCAG 
0121 TCCAGGCTGA TCGGCAACTC CCTATATAAT GCCAGCATGC CCAGAGATGT CGCCTACGGA 
0181 TCGCTAGTGA CAATCAAGAA CCACAAGACG GGCGGAGGCT ACCTGCACTC GCATCATCAC 
0241 CTGTATCCCA AGGGATCTGG CGCTAGGCAG CAGCAGGTTA CCACTTACAC CCACAAGGAC 
0301 GAGAACAACA AGTGGCTAAT CAGGCCGCAC AACAAGCCGG GTCCACCAAA GGGCAAGGTA 
0361 CAGATCCTCC GGCACGGGGA CCTCGTCCGC CTGACTCACA TGGCGACCAG GAGAAATCTG 
0421 CATTCCCACA ACGAACCTGC ACCCATGACC AAGAAGCATT TGCAGGTCAC AGGCTATGGC 
0481 GAGTTGGGAC TAGGCGATG 
 in silico PCR Fragment
0001 tgccgggcca tcaccctgat tgtctggccc gttctcctct acatcctgtt cttctacatt 
0061 cacctgagtg tccttaaccg cagcggcaac ggagatgggt tctatagttc ggcctttcag 
0121 tccaggctga tcggcaactc cctatataat gccagcatgc ccagagatgt cgcctacgga 
0181 tcgctagtga caatcaagaa ccacaagacg ggcggaggct acctgcactc gcatcatcac 
0241 ctgtatccca agggatctgg cgctaggcag cagcaggtta ccacttacac ccacaaggac 
0301 gagaacaaca agtggctaat caggccgcac aacaagccgg gtccaccaaa gggcaaggta 
0361 cagatcctcc ggcacgggga cctcgtccgc ctgactcaca tggcgaccag gagaaatctg 
0421 cattcccaca acgaacctgc acccatgacc aagaagcatt tgcaggtcac aggctatggc 
0481 gagttgggac taggcgat 
 Assemble Data

12311R-1.IR full       1   TGCCGGGCCATCACCCTGATTGTCTGGCCCGTTCTCCTCTACATCCTGTTCTTCTACATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     1   TGCCGGGCCATCACCCTGATTGTCTGGCCCGTTCTCCTCTACATCCTGTTCTTCTACATT 60


12311R-1.IR full       61  CACCTGAGTGTCCTTAACCGCAGCGGCAACGGAGATGGGTTCTATAGTTCGGCCTTTCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     61  CACCTGAGTGTCCTTAACCGCAGCGGCAACGGAGATGGGTTCTATAGTTCGGCCTTTCAG 120


12311R-1.IR full       121 TCCAGGCTGATCGGCAACTCCCTATATAATGCCAGCATGCCCAGAGATGTCGCCTACGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     121 TCCAGGCTGATCGGCAACTCCCTATATAATGCCAGCATGCCCAGAGATGTCGCCTACGGA 180


12311R-1.IR full       181 TCGCTAGTGACAATCAAGAACCACAAGACGGGCGGAGGCTACCTGCACTCGCATCATCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     181 TCGCTAGTGACAATCAAGAACCACAAGACGGGCGGAGGCTACCTGCACTCGCATCATCAC 240


12311R-1.IR full       241 CTGTATCCCAAGGGATCTGGCGCTAGGCAGCAGCAGGTTACCACTTACACCCACAAGGAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     241 CTGTATCCCAAGGGATCTGGCGCTAGGCAGCAGCAGGTTACCACTTACACCCACAAGGAC 300


12311R-1.IR full       301 GAGAACAACAAGTGGCTAATCAGGCCGCACAACAAGCCGGGTCCACCAAAGGGCAAGGTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     301 GAGAACAACAAGTGGCTAATCAGGCCGCACAACAAGCCGGGTCCACCAAAGGGCAAGGTA 360


12311R-1.IR full       361 CAGATCCTCCGGCACGGGGACCTCGTCCGCCTGACTCACATGGCGACCAGGAGAAATCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     361 CAGATCCTCCGGCACGGGGACCTCGTCCGCCTGACTCACATGGCGACCAGGAGAAATCTG 420


12311R-1.IR full       421 CATTCCCACAACGAACCTGCACCCATGACCAAGAAGCATTTGCAGGTCACAGGCTATGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12311R-1.in silico     421 CATTCCCACAACGAACCTGCACCCATGACCAAGAAGCATTTGCAGGTCACAGGCTATGGC 480


12311R-1.IR full       481 GAGTTGGGACTAGGCGATG 499
                           |||||||||||||||||| 
12311R-1.in silico     481 GAGTTGGGACTAGGCGAT- 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_130502.2  Protein O-mannosyltransferase 2 CG12311-RA (Pomt2), mRNA 
NM_143535.1  CG15534-RA (CG15534), mRNA 
NM_140777.1  CG7320-RA (CG7320), mRNA 
NM_136591.3  CG8213-RA (CG8213), mRNA 
NM_135492.3  CG4747-RA (CG4747), mRNA 
NM_139995.1  CG6511-RA (CG6511), mRNA 
NM_135438.2  CG13110-RA (CG13110), mRNA 
NM_139792.2  zero population growth CG10125-RA (zpg), mRNA 
NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
NM_206493.1  dpr9 CG33485-RA (dpr9), mRNA 
NM_057400.3  spineless CG6993-RA (ss), mRNA 
NM_134929.2  polypeptide GalNAc transferase 2 CG3254-RA (pgant2), mRNA 
NM_141050.1  CG12972-RA (CG12972), mRNA 
NM_142396.1  CG7397-RA (CG7397), mRNA 
NM_139962.3  monkey king protein CG7163-RB, transcript variant B (mkg-p), mRNA 
NM_176299.1  CG33057-RA, transcript variant A (CG33057), mRNA 
NM_168272.1  monkey king protein CG7163-RA, transcript variant A (mkg-p), mRNA 
NM_137169.3  charlatan CG11798-RA, transcript variant A (chn), mRNA 
NM_168671.2  CG32158-RA, transcript variant A (CG32158), mRNA 
NM_001043082.1  charlatan CG11798-RC, transcript variant C (chn), mRNA 
NM_206119.1  charlatan CG11798-RB, transcript variant B (chn), mRNA 
NM_138143.1  CG12851-RA (CG12851), mRNA 
NM_001043081.1  charlatan CG11798-RD, transcript variant D (chn), mRNA 
NM_137793.1  CG13502-RA, transcript variant A (CG13502), mRNA 
NM_166506.1  CG13502-RB, transcript variant B (CG13502), mRNA 
NM_138050.2  CG3363-RA (CG3363), mRNA 
NM_142461.2  CG14309-RA (CG14309), mRNA 
NM_080366.2  Elongation factor 2b CG2238-RA, transcript variant A (Ef2b), mRNA 
NM_165395.1  Elongation factor 2b CG2238-RC, transcript variant C (Ef2b), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.