National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12297R-2 
 Symbol BG4  Full Name BG4 
 CG No CG12297  Old CG No CG12297 
 Synonyms dFADD, FADD, Fadd, dFadd, CG12297, BG4 
 Accession No (Link to NCBI) NM_142749.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGACTGCAGGCAGGCACTGGA 
 Primer Seq. 3'
aatctagaggtaccTCGCCAATAGCGACCCAGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGACTGCAgG CAGGCACTGG AGCTACGACA AGCCTCAAAC AAATCGCCAT TGATGGATGC 
0061 ACCGAGAACG TGGAGCAGTT GAAACTAATT TTTGTCGAAG AGATTGGTTC GCGACGCAGA 
0121 TCGGATTGCA TACGAACAAT CGAGGATTTA ATTGACTGCC TGGAACGAGC GGACGAACTG 
0181 TCGGAGTACA ATGTTGAGCC ACTGCGCCNG GATGTCAGGC AATATGCCAC AGCTCATCGA 
0241 GGCTCTGAGC GCCTACACAC CGCCGGAAAA CATTCTTGGA CATCCGGTTA ATCTGTACCA 
0301 GGAACTACGA TTGGCCGAGG AACTTCGTCA GCAACTCCGG ATTGCTCCAG CTTCCCAGAA 
0361 TGCTCAGCCA TCAGTTTCCG AAtNNGNTGC CGCTGTGCCT CCAACAGCAA TCCAAAACTA 
0421 TGCCACCCCA GCTGCTTTTA CGGATCACAA ACGAACGATG GTCTTTAAGA AAATATCCGA 
0481 GGAACTGGGT CGCTATTGGC GA 
 in silico PCR Fragment
0001 TGACTGCAGG CAGGCACTGG AGCTACGAC- AGCCTCAAAC AAATCGCCAT TGATGGATGC 
0061 ACCGAGAACG TGGAGCAGTT GAAACTAATT TTTGTCGAAG AGATTGGTTC GCGACGCAGA 
0121 TCGGATTGCA TACGAACCAT CGAGGATTTA ATTGACTGCC TGGAACGAGC GGACGAACTA 
0181 TCGGAGTACA ATGTGGAGCC ACTGCGCC-G GATATCAGGC AATATGCCAC AGCTCATCGA 
0241 GGCTCTGAGC GCCTACACAA AGCCGGAAAA CATTCTTGGA CATCCGGTTA ATCTGTACCA 
0301 GGAACTCCGA TTGGCCGAGG AACTTCGTCA GCAGCTCCGT ATTGCTCCAG CTTCCCAGAA 
0361 TGCTCAGCCA TCAGTTTCGG AATTAGCTGC CGCTGTGCCT CCAACAGCAA TCCAAAACTA 
0421 TGCCACCCCA GCTGCTTTTA CGGATCACAA ACGAACGATG GTCTTTAAGA AAATATCCGA 
0481 GGAACTGGGT CGCTATTGGC GA 
 Assemble Data

12297R-2.IR_full       1   TGACTGCAGGCAGGCACTGGAGCTACGACAAGCCTCAAACAAATCGCCATTGATGGATGC 60
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
12297R-2.in silico     1   TGACTGCAGGCAGGCACTGGAGCTACGAC-AGCCTCAAACAAATCGCCATTGATGGATGC 60


12297R-2.IR_full       61  ACCGAGAACGTGGAGCAGTTGAAACTAATTTTTGTCGAAGAGATTGGTTCGCGACGCAGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12297R-2.in silico     61  ACCGAGAACGTGGAGCAGTTGAAACTAATTTTTGTCGAAGAGATTGGTTCGCGACGCAGA 120


12297R-2.IR_full       121 TCGGATTGCATACGAACAATCGAGGATTTAATTGACTGCCTGGAACGAGCGGACGAACTG 180
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| 
12297R-2.in silico     121 TCGGATTGCATACGAACCATCGAGGATTTAATTGACTGCCTGGAACGAGCGGACGAACTA 180


12297R-2.IR_full       181 TCGGAGTACAATGTTGAGCCACTGCGCCNGGATGTCAGGCAATATGCCACAGCTCATCGA 240
                           |||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||
12297R-2.in silico     181 TCGGAGTACAATGTGGAGCCACTGCGCC-GGATATCAGGCAATATGCCACAGCTCATCGA 240


12297R-2.IR_full       241 GGCTCTGAGCGCCTACACACCGCCGGAAAACATTCTTGGACATCCGGTTAATCTGTACCA 300
                           |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||
12297R-2.in silico     241 GGCTCTGAGCGCCTACACAAAGCCGGAAAACATTCTTGGACATCCGGTTAATCTGTACCA 300


12297R-2.IR_full       301 GGAACTACGATTGGCCGAGGAACTTCGTCAGCAACTCCGGATTGCTCCAGCTTCCCAGAA 360
                           |||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||
12297R-2.in silico     301 GGAACTCCGATTGGCCGAGGAACTTCGTCAGCAGCTCCGTATTGCTCCAGCTTCCCAGAA 360


12297R-2.IR_full       361 TGCTCAGCCATCAGTTTCCGAATNNGNTGCCGCTGTGCCTCCAACAGCAATCCAAAACTA 420
                           |||||||||||||||||| ||||  | |||||||||||||||||||||||||||||||||
12297R-2.in silico     361 TGCTCAGCCATCAGTTTCGGAATTAGCTGCCGCTGTGCCTCCAACAGCAATCCAAAACTA 420


12297R-2.IR_full       421 TGCCACCCCAGCTGCTTTTACGGATCACAAACGAACGATGGTCTTTAAGAAAATATCCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12297R-2.in silico     421 TGCCACCCCAGCTGCTTTTACGGATCACAAACGAACGATGGTCTTTAAGAAAATATCCGA 480


12297R-2.IR_full       481 GGAACTGGGTCGCTATTGGCGA 502
                           ||||||||||||||||||||||
12297R-2.in silico     481 GGAACTGGGTCGCTATTGGCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142749.2  CG12297-RA (BG4), mRNA 
0   NM_137891.1  CG3695-RA (MED23), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   NM_132514.2  CG1837-RA (CG1837), mRNA 
0   NM_169265.1  CG8866-RA, transcript variant A (CG8866), mRNA 
0   NM_141625.2  CG8866-RB, transcript variant B (CG8866), mRNA 
0   NM_137417.1  CG10931-RA (CG10931), mRNA 
0   NM_169907.1  CG5460-RA, transcript variant A (H), mRNA 
0   NM_079694.2  CG5460-RC, transcript variant C (H), mRNA 
0   NM_135331.1  CG7367-RA (CG7367), mRNA 
0   NM_141368.2  CG1151-RA (Osi6), mRNA 
0   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_142298.2  CG14901-RA (Gr89a), mRNA 
0   NM_140112.1  CG14165-RA (CG14165), mRNA 
0   NR_002486.1  CG14165-RA (CG14165), mRNA, miscRNA 
0   NM_140429.3  CG6661-RA (CG6661), mRNA 
0   NM_169901.2  CG4241-RB, transcript variant B (att-ORFA), mRNA 
0   NM_206522.1  CG4241-RC, transcript variant C (att-ORFA), mRNA 
0   NM_206523.1  CG33488-RA, transcript variant A (att-ORFB), mRNA 
0   NM_142634.2  CG4241-RA, transcript variant A (att-ORFA), mRNA 
0   NM_137538.1  CG15100-RA (CG15100), mRNA 
0   NM_137324.1  CG15614-RA (CG15614), mRNA 
0   NM_136976.1  CG17577-RA (Cyp9h1), mRNA 
0   NM_170646.3  CG31349-RE, transcript variant E (pyd), mRNA 
0   NM_080093.2  CG17888-RE, transcript variant E (Pdp1), mRNA 
0   NM_168234.1  CG17888-RA, transcript variant A (Pdp1), mRNA 
0   NM_168236.1  CG17888-RG, transcript variant G (Pdp1), mRNA 
0   NM_168235.1  CG17888-RB, transcript variant B (Pdp1), mRNA 
0   NM_136776.2  CG7686-RA (CG7686), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.