National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12284R-2 
 Symbol th  Full Name thread 
 CG No CG12284  Old CG No CG12284 
 Synonyms DIAP1, DIAPI, DIAP-1, diap1, Diap-1, IAP, DIAP1,, CG12284, dIAP1, DIAP I, Diap1, D-IAP1, DIAP, diap1/thread, Diap-1/Th, diap-1, dIAP, D-iap1, dIAP-1, l(3)j5C8, l(3)S030605b, 0736/01, 1065/03, l(3)72Dc, Iap1, E(rpr)3-1, l(3)S030605, l(3)S106503, th, IAP1, dIap1 
 Accession No (Link to NCBI) NM_079377.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Clavier A, Baillet A, Rincheval-Arnold A, Coléno-Costes A, Lasbleiz C, Mignotte B, Guénal I.
The pro-apoptotic activity of Drosophila Rbf1 involves dE2F2-dependent downregulation of diap1 and buffy mRNA.
Cell Death Dis (2014) 5 e1405 [ PubMed ID = 25188515 ] [ RRC reference ]

Oshima K, Takeda M, Kuranaga E, Ueda R, Aigaki T, Miura M, Hayashi S.
IKK epsilon regulates F actin assembly and interacts with Drosophila IAP1 in cellular morphogenesis.
Curr. Biol. (2006) 16(15) 1531-7 [ PubMed ID = 16887350 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCATCTGTTGTAGCTGATC 
 Primer Seq. 3'
aatctagaggtaccGCCAATCGACTGAATTAGCTG 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 TGGCATCTGT TGTAGCTGAT CTTCCATCTT ATGGACCTAT CGCTTTTGAT CAGGTGGATA 
0061 ACAACACGAA CGCGACCCAG CTATTCAAAA ATAATATAAA CAAAACCAGA ATGAACGATT 
0121 TAAACCGCGA GGAGACGCGA TTAAAGACCT TCACCGACTG GCCGCTGGAC TGGCTGGATA 
0181 AACGCCAATT GGCCCAAACC GGCATGTACT TCACACACGC CGGCGACAAA GTTAAATGCT 
0241 TTTTCTGCGG CGTGGAAATC GATTGCTGGG AGCAGGAGGA TCAGCCCGTG CCGGAACATC 
0301 AGCGATGGTC GCCCAACTGT CCACTGTTGC GCCGGCGCAC TACCAACAAT GTGCCGATCA 
0361 ATGCCGAAGC ATTAGATCGC ATCCTGCCGC CAATAAGCTA CGATATCTGC GGCGCCAACG 
0421 ACTCGACGCT GGAGATGAGG GAGCATGCCT ACGCAGAAGG CGTCATACCC ATGTCGCAGC 
0481 TAATTCAGTC GATTGGC 
 in silico PCR Fragment
0001 TGGCATCTGT TGTAGCTGAT CTTCCGTCTT ATGGACCTAT CGCTTTTGAT CAGGTGGATA 
0061 ACAACACGAA CGCGACCCAG CTATTCAAAA ATAATATAAA CAAAACCAGA ATGAACGATT 
0121 TAAACCGCGA GGAGACGCGA TTAAAGACCT TCACCGACTG GCCGCTGGAC TGGCTGGATA 
0181 AACGCCAATT GGCCCAAACC GGCATGTACT TCACACACGC CGGCGACAAA GTTAAATGCT 
0241 TTTTCTGCGG CGTGGAAATC GGTTGCTGGG AGCAGGAGGA TCAGCCCGTG CCGGAACATC 
0301 AGCGATGGTC GCCCAACTGT CCACTGTTGC GCCGGCGCAC TACCAACAAT GTGCCGATCA 
0361 ATGCCGAAGC ATTAGATCGC ATCCTGCCGC CAATAAGCTA CGATATCTGC GGCGCCAACG 
0421 ACTCGACGCT GGAGATGAGG GAGCATGCCT ACGCAGAAGG CGTCATACCC ATGTCGCAGC 
0481 TAATTCAGTC GATTGGC 
 Assemble Data

12284R-2.IR_full       1   TGGCATCTGTTGTAGCTGATCTTCCATCTTATGGACCTATCGCTTTTGATCAGGTGGATA 60
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
12284R-2.in silico     1   TGGCATCTGTTGTAGCTGATCTTCCGTCTTATGGACCTATCGCTTTTGATCAGGTGGATA 60


12284R-2.IR_full       61  ACAACACGAACGCGACCCAGCTATTCAAAAATAATATAAACAAAACCAGAATGAACGATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     61  ACAACACGAACGCGACCCAGCTATTCAAAAATAATATAAACAAAACCAGAATGAACGATT 120


12284R-2.IR_full       121 TAAACCGCGAGGAGACGCGATTAAAGACCTTCACCGACTGGCCGCTGGACTGGCTGGATA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     121 TAAACCGCGAGGAGACGCGATTAAAGACCTTCACCGACTGGCCGCTGGACTGGCTGGATA 180


12284R-2.IR_full       181 AACGCCAATTGGCCCAAACCGGCATGTACTTCACACACGCCGGCGACAAAGTTAAATGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     181 AACGCCAATTGGCCCAAACCGGCATGTACTTCACACACGCCGGCGACAAAGTTAAATGCT 240


12284R-2.IR_full       241 TTTTCTGCGGCGTGGAAATCGATTGCTGGGAGCAGGAGGATCAGCCCGTGCCGGAACATC 300
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     241 TTTTCTGCGGCGTGGAAATCGGTTGCTGGGAGCAGGAGGATCAGCCCGTGCCGGAACATC 300


12284R-2.IR_full       301 AGCGATGGTCGCCCAACTGTCCACTGTTGCGCCGGCGCACTACCAACAATGTGCCGATCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     301 AGCGATGGTCGCCCAACTGTCCACTGTTGCGCCGGCGCACTACCAACAATGTGCCGATCA 360


12284R-2.IR_full       361 ATGCCGAAGCATTAGATCGCATCCTGCCGCCAATAAGCTACGATATCTGCGGCGCCAACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     361 ATGCCGAAGCATTAGATCGCATCCTGCCGCCAATAAGCTACGATATCTGCGGCGCCAACG 420


12284R-2.IR_full       421 ACTCGACGCTGGAGATGAGGGAGCATGCCTACGCAGAAGGCGTCATACCCATGTCGCAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12284R-2.in silico     421 ACTCGACGCTGGAGATGAGGGAGCATGCCTACGCAGAAGGCGTCATACCCATGTCGCAGC 480


12284R-2.IR_full       481 TAATTCAGTCGATTGGC 497
                           |||||||||||||||||
12284R-2.in silico     481 TAATTCAGTCGATTGGC 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_168644.1  CG12284-RB, transcript variant B (th), mRNA 
100   479  NM_079377.2  CG12284-RA, transcript variant A (th), mRNA 
100   479  NM_168645.1  CG12284-RC, transcript variant C (th), mRNA 
0   NM_136140.2  CG13082-RA (CG13082), mRNA 
0   NM_141602.2  CG11982-RA (CG11982), mRNA 
0   NM_139894.1  CG8492-RA (CG8492), mRNA 
0   NM_142391.3  CG7660-RB, transcript variant B (pxt), mRNA 
0   NM_169776.1  CG7660-RA, transcript variant A (pxt), mRNA 
0   NM_137873.1  CG13530-RA (CG13530), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_142690.1  CG7009-RA (CG7009), mRNA 
0   NM_140673.3  CG32171-RB, transcript variant B (Lmpt), mRNA 
0   NM_206388.1  CG32171-RG, transcript variant G (Lmpt), mRNA 
0   NM_168819.1  CG15881-RA, transcript variant A (CG15881), mRNA 
0   NM_140893.2  CG15881-RB, transcript variant B (CG15881), mRNA 
0   NM_206387.1  CG32171-RH, transcript variant H (Lmpt), mRNA 
0   NM_170635.1  CG32171-RD, transcript variant D (Lmpt), mRNA 
0   NM_206389.1  CG32171-RF, transcript variant F (Lmpt), mRNA 
0   NM_168694.1  CG32171-RC, transcript variant C (Lmpt), mRNA 
0   NM_140676.3  CG32171-RA, transcript variant A (Lmpt), mRNA 
0   NM_206524.1  CG17269-RA (Fancd2), mRNA 
0   NM_165396.1  CG31619-RA, transcript variant A (CG31619), mRNA 
0   NM_001042909.1  CG31619-RC, transcript variant C (CG31619), mRNA 
0   NM_165397.1  CG31619-RB, transcript variant B (CG31619), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_168182.1  CG10077-RB, transcript variant B (CG10077), mRNA 
0   NM_079730.2  CG6669-RA (klg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.