National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12230R-1 
 Symbol car  Full Name carnation 
 CG No CG12230  Old CG No CG12230 
 Synonyms car, Vps33/carnation, Vps33p, Vps33, Dm-Vps33, l(1)G0447, CG12230 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lee YM, Sun YH.
Maintenance of glia in the optic lamina is mediated by EGFR signaling by photoreceptors in adult Drosophila.
PLoS Genet. (2015) 11(4) e1005187 [ PubMed ID = 25909451 ] [ RRC reference ]

Takáts S, Pircs K, Nagy P, Varga Á, Kárpáti M, Hegedűs K, Kramer H, Kovács AL, Sass M, Juhász G.
Interaction of the HOPS complex with Syntaxin 17 mediates autophagosome clearance in Drosophila.
Mol. Biol. Cell (2014) 25(8) 1338-54 [ PubMed ID = 24554766 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCGAGGCATCCGTCTGCTG 
 Primer Seq. 3'
aatctagaggtaccACGACACCCTTGTCGCCGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

12230R-1.IR full        1   ATCAAGGCATCCGTCTGCTGGCCCTCAAGCCGGAGCTTCATTTGCCGCGCGAGGTGGCC 59
                            ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico      1   ATCGAGGCATCCGTCTGCTGGCCCTCAAGCCGGAGCTTCATTTGCCGCGCGAGGTGGCC 59


12230R-1.IR full       61  AATGTGGTGTACGTGATGCGCCCAC-CGTGGCGCTGATGGAGCAGCTGGCCGCCCACGTG 119
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
12230R-1.in silico     61  AATGTGGTGTACGTGATGCGCCCACGCGTGGCGCTGATGGAGCAGCTGGCCGCCCACGTG 119


12230R-1.IR full       121 AAGGCAGGCGGAAGAGCGGCCGCTGGACGGCAGTACCACATCCTGTTCGCCCCGAGGCGG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico     121 AAGGCAGGCGGAAGAGCGGCCGCTGGACGGCAGTACCACATCCTGTTCGCCCCGAGGCGG 179


12230R-1.IR full       181 TCATGTCTGTGCGTCAGCCAACTGGAGGTCAGCGGCGTGTTGGGCAGCTTCGGAAACATC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico     181 TCATGTCTGTGCGTCAGCCAACTGGAGGTCAGCGGCGTGTTGGGCAGCTTCGGAAACATC 239


12230R-1.IR full       241 GAGGAACTGGCCTGGAACTATCTGCCGCTGGATGTCGACCTGGTATCGATGGAGATNCCC 299
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
12230R-1.in silico     241 GAGGAACTGGCCTGGAACTATCTGCCGCTGGATGTCGACCTGGTATCGATGGAGATGCCC 299


12230R-1.IR full       301 AATGCCTTCCGCGATGTGAGTGTGGACGGTGACACTAGCTCGCTGTATCAGGCGGCAGTG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico     301 AATGCCTTCCGCGATGTGAGTGTGGACGGTGACACTAGCTCGCTGTATCAGGCGGCAGTG 359


12230R-1.IR full       361 GGCCTAGTGCAGCTGCAGCGTCTATACGGTCGCATTCCGAAGATCTACGGAAAAGGAGAG 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico     361 GGCCTAGTGCAGCTGCAGCGTCTATACGGTCGCATTCCGAAGATCTACGGAAAAGGAGAG 419


12230R-1.IR full       421 TTTGCGCACAGGGTATGGGAGCACGCCAAGCAGCTGGGCCGGGATGAGCGGACTCTGTAC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12230R-1.in silico     421 TTTGCGCACAGGGTATGGGAGCACGCCAAGCAGCTGGGCCGGGATGAGCGGACTCTGTAC 479


12230R-1.IR full       481 AACGGCGACAAGGGTGTCAT 499
                           |||||||||||||||||| |
12230R-1.in silico     481 AACGGCGACAAGGGTGTCGT 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.