National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12208R-3 
 Symbol Hr46  Full Name Hormone receptor-like in 46 
 CG No CG33183  Old CG No CG12208 
 Synonyms DHR3, CG12208, CG11823, NR1F4, HR3, 2.4, l(2)k09242, Dhr3, D, dHR3, Hr3, unnamed, 12.6, CG33183, l(2)46CFi, Hr46, Hormone receptor-like in 46, Hormone receptor 3, Complementation group D 
 Accession No (Link to NCBI) NM_176121.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Montagne J, Lecerf C, Parvy JP, Bennion JM, Radimerski T, Ruhf ML, Zilbermann F, Vouilloz N, Stocker H, Hafen E, Kozma SC, Thomas G.
The nuclear receptor DHR3 modulates dS6 kinase-dependent growth in Drosophila.
PLoS Genet. (2010) 6(5) e1000937 [ PubMed ID = 20463884 ] [ RRC reference ]

Cáceres L, Necakov AS, Schwartz C, Kimber S, Roberts IJ, Krause HM.
Nitric oxide coordinates metabolism, growth, and development via the nuclear receptor E75.
Genes Dev. (2011) 25(14) 1476-85 [ PubMed ID = 21715559 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAAATCCTGGCCAACCAGCCCATCATCGTCAAGATCGAGCCCACGCAATCCTTCCACATC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     61  GTGGACGAGGGCGACACGAGAGTACTGAGCTTGCCCCTCAGCGATGCTGA-TAAGCTGGG 120

                           |||| ||||||||||||||||||||||||||||||||||| || || ||||||||||||| silico     121 CGCC-AGTTGGATAGATCTCAAGGATATTGCCGGCCTACA-GGCCGGTGGCGGAGCCACC 180

                           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTGCTGGACGT-CTGCTTCGAGCAGGCCAACGAGGACGGCACCATCATAGCCACCGTGCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     241 GCCGGACTTGGAAAACGAGCTCGAGGCTGAGCTAAAGGCGGAGGGCGAGCCCGAGG-ATG 300

                           |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     301 AGACTGAA-CCAGAGCCTCCGGCGCCCAAGAGATTGGCGACCACCAGGCCAGCACAGTCG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGCCACAACAGCAGCAGCAACAGCAGCAGCAGCAGGTGAAATTCCTATCGGATCCACCG 420

                           |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     421 GCATTGGCACGCTCCAGCAGCTTCAGCAGTCTCAGCAGCTTTAGCAGCATCAGCAATATC 480

                           |||||||||||||||||||||||||| silico     481 AGTTCCGTGTGCAAGAACATGGCCAG 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  45  150  NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
12.65   61  525  1040  1809  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
12.65   61  525  1040  1809  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
12.65   61  525  1040  1809  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
6.22   30  179  456  879  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
6.22   30  179  456  879  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
5.6   27  86  347  599  NM_139493.2  CG2083-RA (CG2083), mRNA 
5.6   27  61  141  300  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
5.6   27  61  141  300  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
5.6   27  59  187  389  NM_079507.2  CG2530-RA (corto), mRNA 
5.39   26  83  266  365  NM_167000.1  CG32778-RA (CG32778), mRNA 
5.18   25  47  228  529  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
5.18   25  47  228  529  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
4.97   24  52  284  496  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
4.97   24  48  260  446  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
4.97   24  38  184  313  NM_132004.2  CG4136-RA (CG4136), mRNA 
4.97   24  37  118  182  NM_057511.3  CG3936-RA (N), mRNA 
4.77   23  55  183  401  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
4.77   23  55  183  400  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
4.77   23  55  183  400  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
4.77   23  55  183  400  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
4.56   22  128  306  600  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
4.56   22  128  306  600  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
4.56   22  91  261  398  NM_134474.4  CG32532-RA (CG32532), mRNA 
4.35   21  120  306  622  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
4.35   21  90  311  546  NM_078797.2  CG13109-RA (tai), mRNA 
4.14   20  83  250  390  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
4.14   20  83  250  390  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
4.14   20  70  181  268  NM_080487.2  CG10572-RA (Cdk8), mRNA 
4.14   20  14  84  154  NM_078933.2  CG11194-RA (Hey), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.