National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12186R-1 
 Symbol Aats-pro  Full Name Prolyl-tRNA synthetase 
 CG No CG12186  Old CG No CG12186 
 Synonyms ProRS, PRS, CG12186, Aats-pro 
 Accession No (Link to NCBI) NM_139480.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Arsham AM, Neufeld TP.
A genetic screen in Drosophila reveals novel cytoprotective functions of the autophagy-lysosome pathway.
PLoS ONE (2009) 4(6) e6068 [ PubMed ID = 19562034 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCCAAAAATGCGGTGGTCA 
 Primer Seq. 3'
aatctagaggtaccTTCCATGGCTGTTTCTTCGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCCAAAAA TGCGGTGGTC AAGCAAACGG AGCAACTGTC CCGCAGCCAA AAGCTGCTGA 
0061 CAGAACTTGG CTTGGTAAAA TCGGGCAGCA ATGGCACCTA CCAGATAATG CCCATGGCCC 
0121 AGCGATCGGT AGACAAGTGC ATTGACTTGG TCCAAAGCAA CATGCAACAG GCTGGTGGGC 
0181 AGAAGATCAC CCTGCCCATC CTGACGCCCA CAGGACTTTG GAAGAANGAC GGGGCGACTG 
0241 GACGGCGATA TATCCGAGTT CTACATGGTG CGGGATCGCA GCGGCNAAGC AGGTTCCTCA 
0301 TGAGTCCAAC CCACGAGGAG GCAGTGANCT GcCATGCTGG CCACCACCTC ACCTATTTCC 
0361 TATAGGCAGC TGCCCTTGAG ACTCTTCCAA ATCGGTCCCA AGTTCAGGGA TGAGCTTAAG 
0421 ACTCGATTTG GTTTGATGCG AGCCAAGGAA TTCCTAATGA AGGACATGTA TTCTTTTGAT 
0481 GTCAGCGAAG AAACAGCCAT GGAA 
 in silico PCR Fragment
0001 CACCCAAAAA TGCGGTGGTC AAGCAAACGG AGCAACTGTC CCGCAGCCAA AAGCTGCTGA 
0061 CAGAACTTGG CTTGGTAAAA TCGGGCAGCA ATGGCACCTA CCAGATAATG CCCATGGCCC 
0121 AGCGATCGGT AGACAAGTGC ATTGACTTGG TCCAAAGCAA CATGCAACAG GCTGGTGGGC 
0181 AGAAGATCAC CCTGCCCATC CTGACGCCCA CAGGACTTTG GAAGAA-GAC GGGGCGACTG 
0241 GACGGCGATA TATCCGAGTT CTACATGGTG CGGGATCGCA GCGGC-AAGC A-GTTCCTCA 
0301 TGAGTCCAAC CCACGAGGAG GCAGTGA-CT GCCATGCTGG CCACCACCTC ACCTATTTCC 
0361 TATCGGCAGC TGCCCTTGAG ACTCTTCCAA ATCGGTCCCA AGTTCAGGGA TGAGCTTAAG 
0421 ACTCGATTTG GTTTGATGCG AGCCAAGGAA TTCCTAATGA AGGACATGTA TTCCTTTGAT 
0481 GTCAGCGAAG AAACAGCCAT GGAA 
 Assemble Data

12186R-1.IR_full       1   CACCCAAAAATGCGGTGGTCAAGCAAACGGAGCAACTGTCCCGCAGCCAAAAGCTGCTGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12186R-1.in silico     1   CACCCAAAAATGCGGTGGTCAAGCAAACGGAGCAACTGTCCCGCAGCCAAAAGCTGCTGA 60


12186R-1.IR_full       61  CAGAACTTGGCTTGGTAAAATCGGGCAGCAATGGCACCTACCAGATAATGCCCATGGCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12186R-1.in silico     61  CAGAACTTGGCTTGGTAAAATCGGGCAGCAATGGCACCTACCAGATAATGCCCATGGCCC 120


12186R-1.IR_full       121 AGCGATCGGTAGACAAGTGCATTGACTTGGTCCAAAGCAACATGCAACAGGCTGGTGGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12186R-1.in silico     121 AGCGATCGGTAGACAAGTGCATTGACTTGGTCCAAAGCAACATGCAACAGGCTGGTGGGC 180


12186R-1.IR_full       181 AGAAGATCACCCTGCCCATCCTGACGCCCACAGGACTTTGGAAGAANGACGGGGCGACTG 240
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
12186R-1.in silico     181 AGAAGATCACCCTGCCCATCCTGACGCCCACAGGACTTTGGAAGAA-GACGGGGCGACTG 240


12186R-1.IR_full       241 GACGGCGATATATCCGAGTTCTACATGGTGCGGGATCGCAGCGGCNAAGCAGGTTCCTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||
12186R-1.in silico     241 GACGGCGATATATCCGAGTTCTACATGGTGCGGGATCGCAGCGGC-AAGCA-GTTCCTCA 300


12186R-1.IR_full       301 TGAGTCCAACCCACGAGGAGGCAGTGANCTGCCATGCTGGCCACCACCTCACCTATTTCC 360
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
12186R-1.in silico     301 TGAGTCCAACCCACGAGGAGGCAGTGA-CTGCCATGCTGGCCACCACCTCACCTATTTCC 360


12186R-1.IR_full       361 TATAGGCAGCTGCCCTTGAGACTCTTCCAAATCGGTCCCAAGTTCAGGGATGAGCTTAAG 420
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12186R-1.in silico     361 TATCGGCAGCTGCCCTTGAGACTCTTCCAAATCGGTCCCAAGTTCAGGGATGAGCTTAAG 420


12186R-1.IR_full       421 ACTCGATTTGGTTTGATGCGAGCCAAGGAATTCCTAATGAAGGACATGTATTCTTTTGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
12186R-1.in silico     421 ACTCGATTTGGTTTGATGCGAGCCAAGGAATTCCTAATGAAGGACATGTATTCCTTTGAT 480


12186R-1.IR_full       481 GTCAGCGAAGAAACAGCCATGGAA 504
                           ||||||||||||||||||||||||
12186R-1.in silico     481 GTCAGCGAAGAAACAGCCATGGAA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139480.1  CG12186-RA (Aats-pro), mRNA 
0   NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
0   NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
0   NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
0   NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
0   NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   NM_141721.1  CG5361-RA (CG5361), mRNA 
0   NM_169569.1  CG31533-RA (CG31533), mRNA 
0   NM_132739.1  CG5321-RA (CG5321), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_080713.3  CG10746-RA (fok), mRNA 
0   NM_132545.2  CG1806-RA (CG1806), mRNA 
0   NM_137218.1  CG12970-RA, transcript variant A (CG12970), mRNA 
0   NM_176180.1  CG12970-RB, transcript variant B (CG12970), mRNA 
0   NM_078639.2  CG13956-RB, transcript variant B (kat80), mRNA 
0   NM_167488.1  CG13956-RA, transcript variant A (kat80), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.