National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12074R-1 
 Symbol CG31004  Full Name CG31004 
 CG No CG31004  Old CG No CG12074 
 Synonyms CG15560, CT5150, CG12074, anon-WO0140519.233, CG31004 
 Accession No (Link to NCBI) NM_170539.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jonusaite S, Beyenbach KW, Meyer H, Paululat A, Izumi Y, Furuse M, Rodan AR.
The septate junction protein Mesh is required for epithelial morphogenesis, ion transport, and paracellular permeability in the Drosophila Malpighian tubule.
Am J Physiol Cell Physiol (2020) 318(3) C675-C694 [ PubMed ID = 31913700 ] [ RRC reference ]

Izumi Y, Yanagihashi Y, Furuse M.
A novel protein complex, Mesh-Ssk, is required for septate junction formation in the Drosophila midgut.
J Cell Sci (2012) 125(Pt 20) 4923-33 [ PubMed ID = 22854041 ] [ RRC reference ]

Izumi Y, Furuse K, Furuse M.
Septate junctions regulate gut homeostasis through regulation of stem cell proliferation and enterocyte behavior in Drosophila.
J Cell Sci (2019) 132(18) [ PubMed ID = 31444286 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGGAGCGGCAGCATGGAAA 
 Primer Seq. 3'
aatctagaggtaccGATAGGCCACACAATCCTGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGGAGCGG CAGCATGGAA AGCGATGGGC GCGGGCTCTC TGCGATAATT GGATTCGCGC 
0061 CGACCGATTC CTCAGAAACT TTGCGGCCGA CCTGCCACTT TGCCCCTGCA CCTTGGACCA 
0121 GGCTGTCCTG GACAANAGGA CGCTTCCGCC CTGACCGCGA GTGCGACAAG GACTCGAACC 
0181 CTANGCTGCC TGCGTCATCG CGGGGCCNAT CCACTGCGTG GTCAGTGGAA CGCCAGTTGC 
0241 CCAAGGAGCT GAACAGCAGT GCTGCTACGA TCGTTATGGC TTCCTGATGC TGACCTACGA 
0301 CCAAATGTGG GGCTCTCGTC CCCGTCGCGT CCACAANCCT GGGCAAGATG CCCTGGAACG 
0361 AGGCCAGCAA GGTGCCCTCG CTGTCCATGT GGTTCCACGA CATGCGCCCC TTCTACTCCT 
0421 GCTGCTACTG GCAGGAGGAG CAGGCGGTGG GCTGCGAAAC CTACCGCTTC GAGCGTCGTC 
0481 CCTCGCAGGA TTGTGTGGcC TATC 
 in silico PCR Fragment
0001 GTGGGAGCGG CAGCATGGAA AGCGATGGGC GCGGGCTCTC TGCGATAATT GGATTCGCGC 
0061 CGACCGATTC CTCAGGAACT TTGCGGCCGA CCTGCCACTT TGCCCCTGCA CCTTGGACCA 
0121 GGCTGTCCTG GACAA-AGGA CGCTTCCGCC CTGACCGCGA GTGCGACAAG GACTCGAACC 
0181 CTA-GCTGCC TGCGTCATCG CGGGGCC-AT CCACTGCGTG GTCAGTGGAA CGCCAGTTGC 
0241 CCAAGGAGCT GAACAGCAGT GCTGCTACGA TCGTTATGGC TTCCTGATGC TGACCTACGA 
0301 CCAAATGTGG GGCTCTCGTC CCCGTCGCGT CCACAA-CCT GGGCAAGATG CCCTGGAACG 
0361 AGGCCAGCAA GGTGCCCTCG CTGTCCATGT GGTTCCACGA CATGCGCCCC TTCTACTCCT 
0421 GCTGCTACTG GCAGGAGGAG CAGGCGGTGG GCTGCGAAAC CTACCGCTTC GAGCGTCGTC 
0481 CCTCGCAGGA TTGTGTGGCC TATC 
 Assemble Data

12074R-1.IR_full       1   GTGGGAGCGGCAGCATGGAAAGCGATGGGCGCGGGCTCTCTGCGATAATTGGATTCGCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     1   GTGGGAGCGGCAGCATGGAAAGCGATGGGCGCGGGCTCTCTGCGATAATTGGATTCGCGC 60


12074R-1.IR_full       61  CGACCGATTCCTCAGAAACTTTGCGGCCGACCTGCCACTTTGCCCCTGCACCTTGGACCA 120
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     61  CGACCGATTCCTCAGGAACTTTGCGGCCGACCTGCCACTTTGCCCCTGCACCTTGGACCA 120


12074R-1.IR_full       121 GGCTGTCCTGGACAANAGGACGCTTCCGCCCTGACCGCGAGTGCGACAAGGACTCGAACC 180
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     121 GGCTGTCCTGGACAA-AGGACGCTTCCGCCCTGACCGCGAGTGCGACAAGGACTCGAACC 180


12074R-1.IR_full       181 CTANGCTGCCTGCGTCATCGCGGGGCCNATCCACTGCGTGGTCAGTGGAACGCCAGTTGC 240
                           ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
12074R-1.in silico     181 CTA-GCTGCCTGCGTCATCGCGGGGCC-ATCCACTGCGTGGTCAGTGGAACGCCAGTTGC 240


12074R-1.IR_full       241 CCAAGGAGCTGAACAGCAGTGCTGCTACGATCGTTATGGCTTCCTGATGCTGACCTACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     241 CCAAGGAGCTGAACAGCAGTGCTGCTACGATCGTTATGGCTTCCTGATGCTGACCTACGA 300


12074R-1.IR_full       301 CCAAATGTGGGGCTCTCGTCCCCGTCGCGTCCACAANCCTGGGCAAGATGCCCTGGAACG 360
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
12074R-1.in silico     301 CCAAATGTGGGGCTCTCGTCCCCGTCGCGTCCACAA-CCTGGGCAAGATGCCCTGGAACG 360


12074R-1.IR_full       361 AGGCCAGCAAGGTGCCCTCGCTGTCCATGTGGTTCCACGACATGCGCCCCTTCTACTCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     361 AGGCCAGCAAGGTGCCCTCGCTGTCCATGTGGTTCCACGACATGCGCCCCTTCTACTCCT 420


12074R-1.IR_full       421 GCTGCTACTGGCAGGAGGAGCAGGCGGTGGGCTGCGAAACCTACCGCTTCGAGCGTCGTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12074R-1.in silico     421 GCTGCTACTGGCAGGAGGAGCAGGCGGTGGGCTGCGAAACCTACCGCTTCGAGCGTCGTC 480


12074R-1.IR_full       481 CCTCGCAGGATTGTGTGGCCTATC 504
                           ||||||||||||||||||||||||
12074R-1.in silico     481 CCTCGCAGGATTGTGTGGCCTATC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170539.1  CG31004-RA, transcript variant A (CG31004), mRNA 
100   482  NM_170540.1  CG31004-RB, transcript variant B (CG31004), mRNA 
0.62   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_080158.2  CG8669-RA, transcript variant A (crc), mRNA 
0   NM_001038841.1  CG8669-RD, transcript variant D (crc), mRNA 
0   NM_176331.1  CG33209-RA (comm3), mRNA 
0   14  NM_001038966.1  CG33967-RA (CG33967), mRNA 
0   10  NM_142180.2  CG4285-RA (CG4285), mRNA 
0   NM_134761.2  CG10869-RA (CG10869), mRNA 
0   NM_135432.1  CG13108-RA (CG13108), mRNA 
0   NM_079086.2  CG5821-RA (qkr58E-2), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_079818.2  CG10002-RA (fkh), mRNA 
0   NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_135247.2  CG9138-RA (SP1070), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_132056.3  CG4790-RA (fs(1)M3), mRNA 
0   NM_164931.1  CG31719-RB, transcript variant B (RluA-1), mRNA 
0   NM_164930.1  CG31719-RA, transcript variant A (RluA-1), mRNA 
0   NM_164932.1  CG31719-RC, transcript variant C (RluA-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.