National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12072R-1 
 Symbol wts  Full Name warts 
 CG No CG12072  Old CG No CG12072 
 Synonyms Lats/Warts, Warts/Lats, lats, Dlats, Warts, dmLATS, LATS, lts, WTS/LATS, CG12072, warts/lats, Lats, l(3)100Aa, wts, wart, Wts/Lats, wts/lats, warts, Wts 
 Accession No (Link to NCBI) NM_170524.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Vissers JH, Manning SA, Kulkarni A, Harvey KF.
A Drosophila RNAi library modulates Hippo pathway-dependent tissue growth.
Nat Commun (2016) 7 10368 [ PubMed ID = 26758424 ] [ RRC reference ]

Enomoto M, Kizawa D, Ohsawa S, Igaki T.
JNK signaling is converted from anti- to pro-tumor pathway by Ras-mediated switch of Warts activity.
Dev. Biol. (2015) 403(2) 162-71 [ PubMed ID = 25967126 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Turkel N, Sahota VK, Bolden JE, Goulding KR, Doggett K, Willoughby LF, Blanco E, Martin-Blanco E, Corominas M, Ellul J, Aigaki T, Richardson HE, Brumby AM.
The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.
PLoS Genet. (2013) 9(7) e1003627 [ PubMed ID = 23874226 ] [ RRC reference ]

Fernández BG, Gaspar P, Brás-Pereira C, Jezowska B, Rebelo SR, Janody F.
Actin-Capping Protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila.
Development (2011) 138(11) 2337-46 [ PubMed ID = 21525075 ] [ RRC reference ]

Doggett K, Grusche FA, Richardson HE, Brumby AM.
Loss of the Drosophila cell polarity regulator Scribbled promotes epithelial tissue overgrowth and cooperation with oncogenic Ras-Raf through impaired Hippo pathway signaling.
BMC Dev. Biol. (2011) 11 57 [ PubMed ID = 21955824 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCAGCGGGCGAAAAAAGGGG 
 Primer Seq. 3'
aatctagaggtaccGCTGGTGGGTGTGGTGCGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCAGCGGGC GAAAAAAAGG gcGGTCGCCC CAATGATAAA TACACGGCGG AAGCCCTCGA 
0061 GAGCATCAAG CAGGACCTAA CCCGATTTGA AGTACAAAAT AACCATAGGA ATAATCAGAA 
0121 TTACACACCT CTGCGATACA CGGCGACCAA CGGACGCAAC GATGCACTTA CTCCTGACTA 
0181 TCACCACGCC AAGCAGCCGA TGGAGCTGCC ACCCTCCGCC TCTCCTGCTC CGGACGTGGT 
0241 CATACCGCCG CCGCCCGCCA TTGTAGGTCA GCCCGGAGCC GGCTCCATAT CCGTATCCGG 
0301 TGTGGGCGTT GGAGTGGTGG GTGTGGCGAA CGGACGTGTG CCAAAGATGA TGACGGCCCT 
0361 AATGCCAAAC AAACTGATCC GGAAGCCGAG CATCGAACGG GACACGGCGA GCAGTCACTA 
0421 CCTGCGCTGC AGTCCGGCTC TGGACTCCGG AGCCGGTAGC TCCCGATCGG ACAGCCCCCA 
0481 TTCGCACCAC ACCCACCAGC  
 in silico PCR Fragment
0001 TCCAGCGGGC GAAAAAAGGG GCGGTCGCCC CAATGATAAA TACACGGCGG AAGCCCTCGA 
0061 GAGCATCAAG CAGGACCTAA CCCGATTTGA AGTACAAAAT AACCATAGGA ATAATCAGAA 
0121 TTACACACCT CTGCGATACA CGGCGACCAA CGGACGCAAC GATGCACTTA CTCCTGACTA 
0181 TCACCACGCC AAGCAGCCGA TGGAGCCGCC ACCCTCCGCC TCTCCTGCTC CGGACGTGGT 
0241 CATACCGCCG CCGCCCGCCA TTGTAGGTCA GCCCGGAGCC GGCTCCATAT CCGTATCCGG 
0301 TGTGGGCGTT GGAGTGGTGG GTGTGGCGAA CGGACGTGTG CCAAAGATGA TGACGGCCCT 
0361 AATGCCAAAC AAACTGATCC GGAAGCCGAG CATCGAACGG GACACGGCGA GCAGTCACTA 
0421 CCTGCGCTGC AGTCCGGCTC TGGACTCCGG AGCCGGTAGC TCCCGATCGG ACAGCCCCCA 
0481 TTCGCACCAC ACCCACCAGC  
 Assemble Data

12072R-1.IR_full       1   TCCAGCGGGCGAAAAAAAGGGCGGTCGCCCCAATGATAAATACACGGCGGAAGCCCTCGA 60
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     1   TCCAGCGGGCGAAAAAAGGGGCGGTCGCCCCAATGATAAATACACGGCGGAAGCCCTCGA 60


12072R-1.IR_full       61  GAGCATCAAGCAGGACCTAACCCGATTTGAAGTACAAAATAACCATAGGAATAATCAGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     61  GAGCATCAAGCAGGACCTAACCCGATTTGAAGTACAAAATAACCATAGGAATAATCAGAA 120


12072R-1.IR_full       121 TTACACACCTCTGCGATACACGGCGACCAACGGACGCAACGATGCACTTACTCCTGACTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     121 TTACACACCTCTGCGATACACGGCGACCAACGGACGCAACGATGCACTTACTCCTGACTA 180


12072R-1.IR_full       181 TCACCACGCCAAGCAGCCGATGGAGCTGCCACCCTCCGCCTCTCCTGCTCCGGACGTGGT 240
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
12072R-1.in silico     181 TCACCACGCCAAGCAGCCGATGGAGCCGCCACCCTCCGCCTCTCCTGCTCCGGACGTGGT 240


12072R-1.IR_full       241 CATACCGCCGCCGCCCGCCATTGTAGGTCAGCCCGGAGCCGGCTCCATATCCGTATCCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     241 CATACCGCCGCCGCCCGCCATTGTAGGTCAGCCCGGAGCCGGCTCCATATCCGTATCCGG 300


12072R-1.IR_full       301 TGTGGGCGTTGGAGTGGTGGGTGTGGCGAACGGACGTGTGCCAAAGATGATGACGGCCCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     301 TGTGGGCGTTGGAGTGGTGGGTGTGGCGAACGGACGTGTGCCAAAGATGATGACGGCCCT 360


12072R-1.IR_full       361 AATGCCAAACAAACTGATCCGGAAGCCGAGCATCGAACGGGACACGGCGAGCAGTCACTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     361 AATGCCAAACAAACTGATCCGGAAGCCGAGCATCGAACGGGACACGGCGAGCAGTCACTA 420


12072R-1.IR_full       421 CCTGCGCTGCAGTCCGGCTCTGGACTCCGGAGCCGGTAGCTCCCGATCGGACAGCCCCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12072R-1.in silico     421 CCTGCGCTGCAGTCCGGCTCTGGACTCCGGAGCCGGTAGCTCCCGATCGGACAGCCCCCA 480


12072R-1.IR_full       481 TTCGCACCACACCCACCAGC 500
                           ||||||||||||||||||||
12072R-1.in silico     481 TTCGCACCACACCCACCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170524.1  CG12072-RA (wts), mRNA 
0.2   NM_143241.1  CG5484-RC, transcript variant C (CG5484), mRNA 
0.2   NM_170284.1  CG5484-RA, transcript variant A (CG5484), mRNA 
0.2   NM_170285.1  CG5484-RB, transcript variant B (CG5484), mRNA 
0   NM_141780.2  CG4674-RA (CG4674), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165827.1  CG13204-RB, transcript variant B (CG13204), mRNA 
0   NM_136188.2  CG10949-RA (CG10949), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_078647.3  CG9907-RA, transcript variant A (para), mRNA 
0   NM_001042815.1  CG9907-RB, transcript variant B (para), mRNA 
0   NM_001042816.1  CG9907-RC, transcript variant C (para), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   NM_164773.1  CG7123-RB, transcript variant B (LanB1), mRNA 
0   NM_057270.3  CG7123-RA, transcript variant A (LanB1), mRNA 
0   NR_001953.1  CR32028, miscRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_132766.2  CG9053-RA, transcript variant A (CG9053), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_167427.1  CG9053-RB, transcript variant B (CG9053), mRNA 
0   NM_142474.1  CG14304-RA (CG14304), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.