National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12072R-1 
 Symbol wts  Full Name warts 
 CG No CG12072  Old CG No CG12072 
 Synonyms Lats/Warts, Warts/Lats, lats, Dlats, Warts, dmLATS, LATS, lts, WTS/LATS, CG12072, warts/lats, Lats, l(3)100Aa, wts, wart, Wts/Lats, wts/lats, warts, Wts 
 Accession No (Link to NCBI) NM_170524.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Vissers JH, Manning SA, Kulkarni A, Harvey KF.
A Drosophila RNAi library modulates Hippo pathway-dependent tissue growth.
Nat Commun (2016) 7 10368 [ PubMed ID = 26758424 ] [ RRC reference ]

Enomoto M, Kizawa D, Ohsawa S, Igaki T.
JNK signaling is converted from anti- to pro-tumor pathway by Ras-mediated switch of Warts activity.
Dev. Biol. (2015) 403(2) 162-71 [ PubMed ID = 25967126 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Turkel N, Sahota VK, Bolden JE, Goulding KR, Doggett K, Willoughby LF, Blanco E, Martin-Blanco E, Corominas M, Ellul J, Aigaki T, Richardson HE, Brumby AM.
The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state.
PLoS Genet. (2013) 9(7) e1003627 [ PubMed ID = 23874226 ] [ RRC reference ]

Doggett K, Grusche FA, Richardson HE, Brumby AM.
Loss of the Drosophila cell polarity regulator Scribbled promotes epithelial tissue overgrowth and cooperation with oncogenic Ras-Raf through impaired Hippo pathway signaling.
BMC Dev. Biol. (2011) 11 57 [ PubMed ID = 21955824 ] [ RRC reference ]

Fernández BG, Gaspar P, Brás-Pereira C, Jezowska B, Rebelo SR, Janody F.
Actin-Capping Protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila.
Development (2011) 138(11) 2337-46 [ PubMed ID = 21525075 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     1   TCCAGCGGGCGAAAAAAGGGGCGGTCGCCCCAATGATAAATACACGGCGGAAGCCCTCGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCATCAAGCAGGACCTAACCCGATTTGAAGTACAAAATAACCATAGGAATAATCAGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTACACACCTCTGCGATACACGGCGACCAACGGACGCAACGATGCACTTACTCCTGACTA 180

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     181 TCACCACGCCAAGCAGCCGATGGAGCCGCCACCCTCCGCCTCTCCTGCTCCGGACGTGGT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATACCGCCGCCGCCCGCCATTGTAGGTCAGCCCGGAGCCGGCTCCATATCCGTATCCGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGTGGGCGTTGGAGTGGTGGGTGTGGCGAACGGACGTGTGCCAAAGATGATGACGGCCCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AATGCCAAACAAACTGATCCGGAAGCCGAGCATCGAACGGGACACGGCGAGCAGTCACTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCTGCGCTGCAGTCCGGCTCTGGACTCCGGAGCCGGTAGCTCCCGATCGGACAGCCCCCA 480

12072R-1.IR_full       481 TTCGCACCACACCCACCAGC 500
                           |||||||||||||||||||| silico     481 TTCGCACCACACCCACCAGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170524.1  CG12072-RA (wts), mRNA 
0.2   NM_143241.1  CG5484-RC, transcript variant C (CG5484), mRNA 
0.2   NM_170284.1  CG5484-RA, transcript variant A (CG5484), mRNA 
0.2   NM_170285.1  CG5484-RB, transcript variant B (CG5484), mRNA 
0   NM_141780.2  CG4674-RA (CG4674), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165827.1  CG13204-RB, transcript variant B (CG13204), mRNA 
0   NM_136188.2  CG10949-RA (CG10949), mRNA 
0   NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_078647.3  CG9907-RA, transcript variant A (para), mRNA 
0   NM_001042815.1  CG9907-RB, transcript variant B (para), mRNA 
0   NM_001042816.1  CG9907-RC, transcript variant C (para), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   NM_164773.1  CG7123-RB, transcript variant B (LanB1), mRNA 
0   NM_057270.3  CG7123-RA, transcript variant A (LanB1), mRNA 
0   NR_001953.1  CR32028, miscRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_132766.2  CG9053-RA, transcript variant A (CG9053), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_167427.1  CG9053-RB, transcript variant B (CG9053), mRNA 
0   NM_142474.1  CG14304-RA (CG14304), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.