National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12052R-1 
 Symbol lola  Full Name longitudinals lacking 
 CG No CG12052  Old CG No CG12052 
 Synonyms CG12052, eyeful, CG18381, CG18379, CG18378, CG30012, BTB-IV, LD03274, l(2)00642, l(2)s3697, bs06a08.y1, NEST:bs06a08, BcDNA:RH31485, sw59, CG30014, CG30013, CG18380, CG18376, BtbIV, BEST:LD03274, BcDNA:LD17006, lola 
 Accession No (Link to NCBI) NM_170623.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hao X, Wang S, Lu Y, Yu W, Li P, Jiang D, Guo T, Li M, Li J, Xu J, Wu W, Ho MS, Zhang L.
Lola regulates Drosophila adult midgut homeostasis via non-canonical hippo signaling.
Elife (2020) 9 [ PubMed ID = 31934851 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTGTTCGACACGTTGCTGGA 
 Primer Seq. 3'
aatctagaggtaccTGCTGCGACGTCGGACTTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTGTTCGAC ACGTTGCTGG AGAACGAGAC TCTAGTCGAT TGCACGCTAG CCGCCGAGGG 
0061 CAAATTTCTC AAGGCCCACA AGGTGGTGCT GTCAGCATGC AGTCCCTACT TTGCTACCTT 
0121 ACTACAAGAA CAGTACGACA AACATCCCAT CTTTATACTC AAGGATGTCA AGTACCAAGA 
0181 GCTGCGCGCC ATGATGGACT ACATGTACCG CGGCGAGGTC AATATCTCGC AGGATCAGCT 
0241 GGCCGCTCTG CNTCAAGGCC GCCGAATCGC TTCAGATCAA GGGCCTTTCG GACAATCGCA 
0301 CTGGCGGCGG AGTAGCTCCC AAGCCANGAG TCCTCCGGCC ATCATCGCGG CGGTAAGCTG 
0361 AGCGGTGCCT ACACACTGGA GCAAACTAAG CGGGCTCGAC TGGCCACCGG CGGAGCGATG 
0421 GATACGTCTG GCGATGTGTC CGGTTCAGCG CGAGGGCTCC TCGAGTCCGT CgNGTCGTCG 
0481 CCGAAAAGTC CGACGTCGCA GCA 
 in silico PCR Fragment
0001 CGTGTTCGAC ACGTTGCTGG AGAACGAGAC TCTAGTCGAT TGCACGCTAG CCGCCGAGGG 
0061 CAAATTTCTC AAGGCCCACA AGGTGGTGCT GTCAGCATGC AGTCCCTACT TTGCTACCTT 
0121 ACTACAAGAA CAGTACGACA AACATCCCAT CTTTATACTC AAGGATGTCA AGTACCAAGA 
0181 GCTGCGCGCC ATGATGGACT ACATGTACCG CGGCGAGGTC AATATCTCGC AGGATCAGCT 
0241 GGCCGCTCTG C-TCAAGGCC GCCGAATCGC TTCAGATCAA GGGCCTTTCG GACAATCGCA 
0301 CTGGCGGCGG AGTAGCTCCC AAGCCA-GAG TCCTCCGGCC ATCATCGCGG CGGTAAGCTG 
0361 AGCGGTGCCT ACACACTGGA GCAAACTAAG CGGGCTCGAC TGGCCACCGG CGGAGCGATG 
0421 GATACGTCTG GCGATGTGTC CGGTTC-GCG CGAGGGCTCC TCGAGTCCGT CGCGTCGTCG 
0481 CCGAAAAGTC CGACGTCGCA GCA 
 Assemble Data

12052R-1.IR_full       1   CGTGTTCGACACGTTGCTGGAGAACGAGACTCTAGTCGATTGCACGCTAGCCGCCGAGGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     1   CGTGTTCGACACGTTGCTGGAGAACGAGACTCTAGTCGATTGCACGCTAGCCGCCGAGGG 60


12052R-1.IR_full       61  CAAATTTCTCAAGGCCCACAAGGTGGTGCTGTCAGCATGCAGTCCCTACTTTGCTACCTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     61  CAAATTTCTCAAGGCCCACAAGGTGGTGCTGTCAGCATGCAGTCCCTACTTTGCTACCTT 120


12052R-1.IR_full       121 ACTACAAGAACAGTACGACAAACATCCCATCTTTATACTCAAGGATGTCAAGTACCAAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     121 ACTACAAGAACAGTACGACAAACATCCCATCTTTATACTCAAGGATGTCAAGTACCAAGA 180


12052R-1.IR_full       181 GCTGCGCGCCATGATGGACTACATGTACCGCGGCGAGGTCAATATCTCGCAGGATCAGCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     181 GCTGCGCGCCATGATGGACTACATGTACCGCGGCGAGGTCAATATCTCGCAGGATCAGCT 240


12052R-1.IR_full       241 GGCCGCTCTGCNTCAAGGCCGCCGAATCGCTTCAGATCAAGGGCCTTTCGGACAATCGCA 300
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     241 GGCCGCTCTGC-TCAAGGCCGCCGAATCGCTTCAGATCAAGGGCCTTTCGGACAATCGCA 300


12052R-1.IR_full       301 CTGGCGGCGGAGTAGCTCCCAAGCCANGAGTCCTCCGGCCATCATCGCGGCGGTAAGCTG 360
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
12052R-1.in silico     301 CTGGCGGCGGAGTAGCTCCCAAGCCA-GAGTCCTCCGGCCATCATCGCGGCGGTAAGCTG 360


12052R-1.IR_full       361 AGCGGTGCCTACACACTGGAGCAAACTAAGCGGGCTCGACTGGCCACCGGCGGAGCGATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12052R-1.in silico     361 AGCGGTGCCTACACACTGGAGCAAACTAAGCGGGCTCGACTGGCCACCGGCGGAGCGATG 420


12052R-1.IR_full       421 GATACGTCTGGCGATGTGTCCGGTTCAGCGCGAGGGCTCCTCGAGTCCGTCGNGTCGTCG 480
                           |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||
12052R-1.in silico     421 GATACGTCTGGCGATGTGTCCGGTTC-GCGCGAGGGCTCCTCGAGTCCGTCGCGTCGTCG 480


12052R-1.IR_full       481 CCGAAAAGTCCGACGTCGCAGCA 503
                           |||||||||||||||||||||||
12052R-1.in silico     481 CCGAAAAGTCCGACGTCGCAGCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176139.2  CG12052-RQ, transcript variant Q (lola), mRNA 
100   482  NM_170621.3  CG12052-RE, transcript variant E (lola), mRNA 
100   482  NM_170620.2  CG12052-RD, transcript variant D (lola), mRNA 
100   482  NM_176129.3  CG12052-RO, transcript variant O (lola), mRNA 
100   482  NM_170618.3  CG12052-RC, transcript variant C (lola), mRNA 
100   482  NM_170619.2  CG12052-RB, transcript variant B (lola), mRNA 
100   482  NM_176140.2  CG12052-RM, transcript variant M (lola), mRNA 
100   482  NM_176138.3  CG12052-RL, transcript variant L (lola), mRNA 
100   482  NM_170623.4  CG12052-RA, transcript variant A (lola), mRNA 
100   482  NM_001032229.1  CG12052-RZ, transcript variant Z (lola), mRNA 
100   482  NM_176137.3  CG12052-RS, transcript variant S (lola), mRNA 
100   482  NM_206085.2  CG12052-RV, transcript variant V (lola), mRNA 
100   482  NM_176136.3  CG12052-RK, transcript variant K (lola), mRNA 
100   482  NM_170622.4  CG12052-RF, transcript variant F (lola), mRNA 
100   482  NM_176132.2  CG12052-RR, transcript variant R (lola), mRNA 
100   482  NM_080027.4  CG12052-RG, transcript variant G (lola), mRNA 
100   482  NM_206083.2  CG12052-RX, transcript variant X (lola), mRNA 
100   482  NM_206082.2  CG12052-RY, transcript variant Y (lola), mRNA 
100   482  NM_176128.3  CG12052-RN, transcript variant N (lola), mRNA 
100   482  NM_206084.2  CG12052-RW, transcript variant W (lola), mRNA 
100   482  NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
100   482  NM_176131.3  CG12052-RP, transcript variant P (lola), mRNA 
100   482  NM_170617.3  CG12052-RH, transcript variant H (lola), mRNA 
100   482  NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
100   482  NM_176134.2  CG12052-RT, transcript variant T (lola), mRNA 
100   482  NM_176135.3  CG12052-RU, transcript variant U (lola), mRNA 
0.2   NM_132049.3  CG12236-RB, transcript variant B (CG12236), mRNA 
0.2   NM_167054.1  CG12236-RA, transcript variant A (CG12236), mRNA 
0   16  NM_163886.1  CG32491-RP, transcript variant P (mod(mdg4)), mRNA 
0   16  NM_163888.1  CG32491-RK, transcript variant K (mod(mdg4)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.