National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12021R-4 
 Symbol Patj  Full Name Patj 
 CG No CG12021  Old CG No CG12021 
 Synonyms Patj, dPatj, dlt, Dlt, DLT, DPATJ, CG12021, dlt:discs lost, DPatj, BcDNA:LD22238, PatJ 
 Accession No (Link to NCBI) NM_134317.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hochapfel F, Denk L, Mendl G, Schulze U, Maaßen C, Zaytseva Y, Pavenstädt H, Weide T, Rachel R, Witzgall R, Krahn MP.
Distinct functions of Crumbs regulating slit diaphragms and endocytosis in Drosophila nephrocytes.
Cell. Mol. Life Sci. (2017) 74(24) 4573-4586 [ PubMed ID = 28717874 ] [ RRC reference ]

Aranjuez G, Kudlaty E, Longworth MS, McDonald JA.
On the role of PDZ domain-encoding genes in Drosophila border cell migration.
G3 (Bethesda) (2012) 2(11) 1379-91 [ PubMed ID = 23173089 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCACCTCAGCGCGGATATT 
 Primer Seq. 3'
aatctagaggtaccCCGAGTTGCGAGCTCCAATAA 
 Predicted Fragment Size
508 
 IR fragment full Seq
0001 ATGCACCTCA GCGCGGATAT TTCCAGCGCC CTTCAGCAGA TCGAGGCAGT GAAGAAGGGC 
0061 ATCGATGAGT CCGACGACCC CAAGCTGCAA ATGCAGNACG GCCGAGAGCC TTAGCACCAT 
0121 TCTGGGCATT CTGCAGGATC CCGTTTTCCG CACCATCGTC CACGTGCAGG ACTCGTTGTC 
0181 CGAGCTGAAC GCCCAGCTGG CTCAGCATCC GTCCATGTTG CCCAACGACT TCGACATCGA 
0241 TGTGGCCGGC AACCTTGTAC TCAGTCTGAA TGGTGGCGAG GTGATGTACG ACTTTGACGA 
0301 ACAGCGCTCT TCCTCGCACT CCCATTCGGC TCCGGGCAGT CCAGATAAGT CCGGAgGCGT 
0361 CGGCGAGGAG CCGCGCCCGC AGAGCCAGAA CTCCAAAGGA GCCGGAGTGG CGGATCTCTA 
0421 CGCCACGNGA CTACGCTCAG ATCCAGGCCA TAGAGCTGGT CAACGACGGC ACGGGTCTCG 
0481 GATTCGGTAT TATTGGAGCT CGCAACTCGG  
 in silico PCR Fragment
0001 ATGCACCTCA GCGCGGATAT TTCCAGCGCC CTTCAGCAGA TCGAGGCAGT GAAGAAGGGC 
0061 ATCGATGAGT CCGACGACCC CAAGCTGCAA ATGCAG-ACG GCCGAGAGCC TTAGCACCAT 
0121 TCTGGGCATT CTGCAGGATC CCGTTTTCCG CACCATCGTC CACGTGCAGG ACTCGTTGTC 
0181 CGAGCTGAAC GCCCAGCTGG CTCAGCATCC GTCCATGTTG CCCAACGACT TCGACATCGA 
0241 TGTGGCCGGC AACCTTGTAC TCAGTCTGAA TGGTGGCGAG GTGATGTACG ACTTTGACGA 
0301 ACAGCGCTCT TCCTCGCACT CCCATTCGGC TCCGGGCAGT CCAGATAAGT CCGGAGGCGT 
0361 CGGCGAGGAG CCGCGCCCGC AGAGCCAGAA CTCCAAAGGA GCCGGAGTGG CGGATCTCTA 
0421 CGCCACG-GA CTACGCTCAG ATCCAGGCCA TAGAGCTGGT CAACGACGGC ACGGGTCTCG 
0481 GATTCGGTAT TATTGGAGCT CGCAACTCGG  
 Assemble Data

12021R-4.IR_full       1   ATGCACCTCAGCGCGGATATTTCCAGCGCCCTTCAGCAGATCGAGGCAGTGAAGAAGGGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     1   ATGCACCTCAGCGCGGATATTTCCAGCGCCCTTCAGCAGATCGAGGCAGTGAAGAAGGGC 60


12021R-4.IR_full       61  ATCGATGAGTCCGACGACCCCAAGCTGCAAATGCAGNACGGCCGAGAGCCTTAGCACCAT 120
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
12021R-4.in silico     61  ATCGATGAGTCCGACGACCCCAAGCTGCAAATGCAG-ACGGCCGAGAGCCTTAGCACCAT 120


12021R-4.IR_full       121 TCTGGGCATTCTGCAGGATCCCGTTTTCCGCACCATCGTCCACGTGCAGGACTCGTTGTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     121 TCTGGGCATTCTGCAGGATCCCGTTTTCCGCACCATCGTCCACGTGCAGGACTCGTTGTC 180


12021R-4.IR_full       181 CGAGCTGAACGCCCAGCTGGCTCAGCATCCGTCCATGTTGCCCAACGACTTCGACATCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     181 CGAGCTGAACGCCCAGCTGGCTCAGCATCCGTCCATGTTGCCCAACGACTTCGACATCGA 240


12021R-4.IR_full       241 TGTGGCCGGCAACCTTGTACTCAGTCTGAATGGTGGCGAGGTGATGTACGACTTTGACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     241 TGTGGCCGGCAACCTTGTACTCAGTCTGAATGGTGGCGAGGTGATGTACGACTTTGACGA 300


12021R-4.IR_full       301 ACAGCGCTCTTCCTCGCACTCCCATTCGGCTCCGGGCAGTCCAGATAAGTCCGGAGGCGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     301 ACAGCGCTCTTCCTCGCACTCCCATTCGGCTCCGGGCAGTCCAGATAAGTCCGGAGGCGT 360


12021R-4.IR_full       361 CGGCGAGGAGCCGCGCCCGCAGAGCCAGAACTCCAAAGGAGCCGGAGTGGCGGATCTCTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     361 CGGCGAGGAGCCGCGCCCGCAGAGCCAGAACTCCAAAGGAGCCGGAGTGGCGGATCTCTA 420


12021R-4.IR_full       421 CGCCACGNGACTACGCTCAGATCCAGGCCATAGAGCTGGTCAACGACGGCACGGGTCTCG 480
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
12021R-4.in silico     421 CGCCACG-GACTACGCTCAGATCCAGGCCATAGAGCTGGTCAACGACGGCACGGGTCTCG 480


12021R-4.IR_full       481 GATTCGGTATTATTGGAGCTCGCAACTCGG 510
                           ||||||||||||||||||||||||||||||
12021R-4.in silico     481 GATTCGGTATTATTGGAGCTCGCAACTCGG 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   490  NM_167917.2  CG12021-RB, transcript variant B (Patj), mRNA 
100   490  NM_057994.4  CG12021-RC, transcript variant C (Patj), mRNA 
100   490  NM_134317.3  CG12021-RA, transcript variant A (Patj), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_132610.2  CG4404-RA (CG4404), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_141212.3  CG9809-RA, transcript variant A (CG9809), mRNA 
0   NM_168996.3  CG9809-RB, transcript variant B (CG9809), mRNA 
0   NM_168997.3  CG9809-RC, transcript variant C (CG9809), mRNA 
0   NM_142532.2  CG5555-RA (CG5555), mRNA 
0   NM_167576.1  CG32559-RA (CG32559), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_132217.2  CG10958-RA (CG10958), mRNA 
0   NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   NM_167571.1  CG12991-RB, transcript variant B (CG12991), mRNA 
0   NM_132995.1  CG12991-RA, transcript variant A (CG12991), mRNA 
0   12  NM_136264.4  CG8663-RA, transcript variant A (nrv3), mRNA 
0   12  NM_165378.1  CG8663-RC, transcript variant C (nrv3), mRNA 
0   12  NM_165379.1  CG8663-RD, transcript variant D (nrv3), mRNA 
0   NM_143702.2  CG5889-RA (Mdh), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   12  NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_143242.2  CG6420-RA (CG6420), mRNA 
0   NM_132192.1  CG1444-RA (CG1444), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.