National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 12021R-3 
 Symbol Patj  Full Name Patj 
 CG No CG12021  Old CG No CG12021 
 Synonyms Patj, dPatj, dlt, Dlt, DLT, DPATJ, CG12021, dlt:discs lost, DPatj, BcDNA:LD22238, PatJ 
 Accession No (Link to NCBI) NM_134317.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Aranjuez G, Kudlaty E, Longworth MS, McDonald JA.
On the role of PDZ domain-encoding genes in Drosophila border cell migration.
G3 (Bethesda) (2012) 2(11) 1379-91 [ PubMed ID = 23173089 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCACCTCAGCGCGGATATTTCCAGCGCCCTTCAGCAGATCGAGGCAGTGAAGAAGGGC 60

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     61  ATCGATGAGTCCGACGACCCCAAGCTGCAAATGCAG-ACGGCCGAGAGCCTTAGCACCAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTGGGCATTCTGCAGGATCCCGTTTTCCGCACCATCGTCCACGTGCAGGACTCGTTGTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGAGCTGAACGCCCAGCTGGCTCAGCATCCGTCCATGTTGCCCAACGACTTCGACATCGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTGGCCGGCAACCTTGTACTCAGTCTGAATGGTGGCGAGGTGATGTACGACTTTGACGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACAGCGCTCTTCCTCGCACTCCCATTCGGCTCCGGGCAGTCCAGATAAGTCCGGAGGCGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGGCGAGGAGCCGCGCCCGCAGAGCCAGAACTCCAAAGGAGCCGGAGTGGCGGATCTCTA 420

                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCCACG-GACTACGCTCAGATCCAGGCCATAGAGCTGGTCAACGACGGCACGGGTCTCG 480

                           |||||||||||||||||||||||||||||| silico     481 GATTCGGTATTATTGGAGCTCGCAACTCGG 510

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   490  NM_167917.2  CG12021-RB, transcript variant B (Patj), mRNA 
100   490  NM_057994.4  CG12021-RC, transcript variant C (Patj), mRNA 
100   490  NM_134317.3  CG12021-RA, transcript variant A (Patj), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_132610.2  CG4404-RA (CG4404), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_165544.1  CG2092-RA, transcript variant A (scra), mRNA 
0   NM_165543.1  CG2092-RB, transcript variant B (scra), mRNA 
0   NM_141212.3  CG9809-RA, transcript variant A (CG9809), mRNA 
0   NM_168996.3  CG9809-RB, transcript variant B (CG9809), mRNA 
0   NM_168997.3  CG9809-RC, transcript variant C (CG9809), mRNA 
0   NM_142532.2  CG5555-RA (CG5555), mRNA 
0   NM_167576.1  CG32559-RA (CG32559), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_132217.2  CG10958-RA (CG10958), mRNA 
0   NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   NM_167571.1  CG12991-RB, transcript variant B (CG12991), mRNA 
0   NM_132995.1  CG12991-RA, transcript variant A (CG12991), mRNA 
0   12  NM_136264.4  CG8663-RA, transcript variant A (nrv3), mRNA 
0   12  NM_165378.1  CG8663-RC, transcript variant C (nrv3), mRNA 
0   12  NM_165379.1  CG8663-RD, transcript variant D (nrv3), mRNA 
0   NM_143702.2  CG5889-RA (Mdh), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   12  NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_143242.2  CG6420-RA (CG6420), mRNA 
0   NM_132192.1  CG1444-RA (CG1444), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.