National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11992R-2 
 Symbol Rel  Full Name Relish 
 CG No CG11992  Old CG No CG11992 
 Synonyms CG11992, rel, REL, ird4, ird, unnamed, l(3)neo36, Rel, Relish 
 Accession No (Link to NCBI) NM_057746.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Yang S, Zhao Y, Yu J, Fan Z, Gong ST, Tang H, Pan L.
Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila.
Cell Host Microbe (2019) [ PubMed ID = 31350199 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGAATCAGTACTACGACCTGGACAATGGGAAAAATGTGATGTTTATGAACGATGCATCCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACCAGTGGCTATAGCAGCAGTACATCACCCAACTCCACCAACCGATCCTTTTCACCAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCCACTCCCCGAAAACCATGGAACTGCAAACGGACTTCGCCAATCTTAATTTGCCCGGCG 180

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCAAT-TCACCACACCAGCCGCCAATGGCAAACTCACCATACCAGAATCAGCTGTTGAAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACGGCGGAATTTGCCAATTGGGTGCTACCAATTTAATAAACTCCACTGGCGTTAGTTTC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCGTTGCTAATGTCACCAGTTTTGGCAACATGTACATGGATCACCAGTACTTTGTGCCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTCCGGCCACTGTGCCACCGTCCCAAAACTTTGGATACCATCAAAATGGCCTGGCATCT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACGGCGATATCAAACACGTGCCGCAGCTGCGGATCGTTGAGCAACCGGTGGAGAAGTTC 480

11992R-2.IR_full       481 CGCTTTCGGTACAAGAGCGAG 501
                           ||||||||||||||||||||| silico     481 CGCTTTCGGTACAAGAGCGAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
100   482  NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
100   482  NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 
52.69   254  NM_206465.1  CG11992-RD, transcript variant D (Rel), mRNA 
0   NM_136900.1  CG8859-RA (Cyp6g2), mRNA 
0   NM_132855.2  CG9038-RA, transcript variant A (UBL3), mRNA 
0   NM_206730.1  CG9038-RB, transcript variant B (UBL3), mRNA 
0   NM_001015224.1  CG17397-PB (CG17397), mRNA 
0   NM_001015223.1  CG17397-PA (CG17397), mRNA 
0   17  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   15  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   15  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   15  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   15  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   15  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_132647.1  CG18076-RC, transcript variant C (shot), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
0   NM_167358.1  CG18076-RC, transcript variant C (shot), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
0   NM_137883.1  CG13535-RA (CG13535), mRNA 
0   NM_166671.1  CG30164-RA (CG30164), mRNA 
0   NM_079935.2  CG8094-RA (Hex-C), mRNA 
0   NM_142966.2  CG6182-RA (CG6182), mRNA 
0   NM_079752.2  CG13608-RA (mRpS24), mRNA 
0   13  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_132713.1  CG11584-RB (CG11584), mRNA 
0   NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   10  NM_169639.2  CG4898-RH, transcript variant H (Tm1), mRNA 
0   10  NM_169638.2  CG4898-RE, transcript variant E (Tm1), mRNA 
0   10  NM_169641.2  CG4898-RI, transcript variant I (Tm1), mRNA 
0   10  NM_169640.1  CG4898-RC, transcript variant C (Tm1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.