National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11992R-1 
 Symbol Rel  Full Name Relish 
 CG No CG11992  Old CG No CG11992 
 Synonyms CG11992, rel, REL, ird4, ird, unnamed, l(3)neo36, Rel, Relish 
 Accession No (Link to NCBI) NM_057746.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yang S, Zhao Y, Yu J, Fan Z, Gong ST, Tang H, Pan L.
Sugar Alcohols of Polyol Pathway Serve as Alarmins to Mediate Local-Systemic Innate Immune Communication in Drosophila.
Cell Host Microbe (2019) [ PubMed ID = 31350199 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAATCAGTACTACGACCTGG 
 Primer Seq. 3'
aatctagaggtaccCTCGCTCTTGTACCGAAAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAATCAGTA CTACGACCTG GACAATGGGA AAAATGTGAT GTTTATGAAC GATGCATCCA 
0061 GCACCAGTGG CTATAGCAGC AGTACATCAC CCAACTCCAC CAACCGATCC TTTTCACCAG 
0121 CCCACTCCCC GAAAACCATG GAACTGCAAA CGGACTTCGC CAATCTTAAT TTGCCCGGCG 
0181 GCAATNTCAC CACACCAGCC GCCAATGGCA AACTCACCAT ACCAGAATCA GCTGTTGAAC 
0241 AACGGCGGAA TTTGCCAATT GGGTGCTACC AATTTAATAA ACTCCACTGG CGTTAGTTTC 
0301 GGCGTTGCTA ATGTCACCAG TTTTGGCAAC ATGTACATGG ATCACCAGTA CTTTGTGCCC 
0361 GCTCCGGCCA CTGTGCCACC GTCCCAAAAC TTTGGATACC ATCAAAATGG CCTGGCATCT 
0421 GACGGCGATA TCAAACACGT GCCGCAGCTG CGGATCGTTG AGCAACCGGT GGAGAAGTTC 
0481 CGCTTTCGGT ACAAGAGCGA G 
 in silico PCR Fragment
0001 TGAATCAGTA CTACGACCTG GACAATGGGA AAAATGTGAT GTTTATGAAC GATGCATCCA 
0061 GCACCAGTGG CTATAGCAGC AGTACATCAC CCAACTCCAC CAACCGATCC TTTTCACCAG 
0121 CCCACTCCCC GAAAACCATG GAACTGCAAA CGGACTTCGC CAATCTTAAT TTGCCCGGCG 
0181 GCAAT-TCAC CACACCAGCC GCCAATGGCA AACTCACCAT ACCAGAATCA GCTGTTGAAC 
0241 AACGGCGGAA TTTGCCAATT GGGTGCTACC AATTTAATAA ACTCCACTGG CGTTAGTTTC 
0301 GGCGTTGCTA ATGTCACCAG TTTTGGCAAC ATGTACATGG ATCACCAGTA CTTTGTGCCC 
0361 GCTCCGGCCA CTGTGCCACC GTCCCAAAAC TTTGGATACC ATCAAAATGG CCTGGCATCT 
0421 GACGGCGATA TCAAACACGT GCCGCAGCTG CGGATCGTTG AGCAACCGGT GGAGAAGTTC 
0481 CGCTTTCGGT ACAAGAGCGA G 
 Assemble Data

11992R-1.IR_full       1   TGAATCAGTACTACGACCTGGACAATGGGAAAAATGTGATGTTTATGAACGATGCATCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     1   TGAATCAGTACTACGACCTGGACAATGGGAAAAATGTGATGTTTATGAACGATGCATCCA 60


11992R-1.IR_full       61  GCACCAGTGGCTATAGCAGCAGTACATCACCCAACTCCACCAACCGATCCTTTTCACCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     61  GCACCAGTGGCTATAGCAGCAGTACATCACCCAACTCCACCAACCGATCCTTTTCACCAG 120


11992R-1.IR_full       121 CCCACTCCCCGAAAACCATGGAACTGCAAACGGACTTCGCCAATCTTAATTTGCCCGGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     121 CCCACTCCCCGAAAACCATGGAACTGCAAACGGACTTCGCCAATCTTAATTTGCCCGGCG 180


11992R-1.IR_full       181 GCAATNTCACCACACCAGCCGCCAATGGCAAACTCACCATACCAGAATCAGCTGTTGAAC 240
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     181 GCAAT-TCACCACACCAGCCGCCAATGGCAAACTCACCATACCAGAATCAGCTGTTGAAC 240


11992R-1.IR_full       241 AACGGCGGAATTTGCCAATTGGGTGCTACCAATTTAATAAACTCCACTGGCGTTAGTTTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     241 AACGGCGGAATTTGCCAATTGGGTGCTACCAATTTAATAAACTCCACTGGCGTTAGTTTC 300


11992R-1.IR_full       301 GGCGTTGCTAATGTCACCAGTTTTGGCAACATGTACATGGATCACCAGTACTTTGTGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     301 GGCGTTGCTAATGTCACCAGTTTTGGCAACATGTACATGGATCACCAGTACTTTGTGCCC 360


11992R-1.IR_full       361 GCTCCGGCCACTGTGCCACCGTCCCAAAACTTTGGATACCATCAAAATGGCCTGGCATCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     361 GCTCCGGCCACTGTGCCACCGTCCCAAAACTTTGGATACCATCAAAATGGCCTGGCATCT 420


11992R-1.IR_full       421 GACGGCGATATCAAACACGTGCCGCAGCTGCGGATCGTTGAGCAACCGGTGGAGAAGTTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11992R-1.in silico     421 GACGGCGATATCAAACACGTGCCGCAGCTGCGGATCGTTGAGCAACCGGTGGAGAAGTTC 480


11992R-1.IR_full       481 CGCTTTCGGTACAAGAGCGAG 501
                           |||||||||||||||||||||
11992R-1.in silico     481 CGCTTTCGGTACAAGAGCGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
100   482  NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
100   482  NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 
52.69   254  NM_206465.1  CG11992-RD, transcript variant D (Rel), mRNA 
0   NM_136900.1  CG8859-RA (Cyp6g2), mRNA 
0   NM_132855.2  CG9038-RA, transcript variant A (UBL3), mRNA 
0   NM_206730.1  CG9038-RB, transcript variant B (UBL3), mRNA 
0   NM_001015224.1  CG17397-PB (CG17397), mRNA 
0   NM_001015223.1  CG17397-PA (CG17397), mRNA 
0   17  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   15  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   15  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   15  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   15  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   15  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_132647.1  CG18076-RC, transcript variant C (shot), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
0   NM_167358.1  CG18076-RC, transcript variant C (shot), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
0   NM_137883.1  CG13535-RA (CG13535), mRNA 
0   NM_166671.1  CG30164-RA (CG30164), mRNA 
0   NM_079935.2  CG8094-RA (Hex-C), mRNA 
0   NM_142966.2  CG6182-RA (CG6182), mRNA 
0   NM_079752.2  CG13608-RA (mRpS24), mRNA 
0   13  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_132713.1  CG11584-RB (CG11584), mRNA 
0   NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   10  NM_169639.2  CG4898-RH, transcript variant H (Tm1), mRNA 
0   10  NM_169638.2  CG4898-RE, transcript variant E (Tm1), mRNA 
0   10  NM_169641.2  CG4898-RI, transcript variant I (Tm1), mRNA 
0   10  NM_169640.1  CG4898-RC, transcript variant C (Tm1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.