National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11988R-1 
 Symbol neur  Full Name neuralized 
 CG No CG11988  Old CG No CG11988 
 Synonyms Neur, neu, CG11988, 1315/05, 1293/09, 0971/15, 0328/12, BEST:LD21494, l(3)neo37, l(3)j9C8, l(3)j9B9, l(3)j9B8, l(3)j6B12, neur 
 Accession No (Link to NCBI) NM_057304.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hamel S, Fantini J, Schweisguth F.
Notch ligand activity is modulated by glycosphingolipid membrane composition in Drosophila melanogaster.
J. Cell Biol. (2010) 188(4) 581-94 [ PubMed ID = 20176925 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGTCTATCGGATATACCAG 
 Primer Seq. 3'
aatctagaggtaccTCCAAAGCGAATTCCACCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGTCTATC GGATATACCA GCCAACTATA TGCAGGGCAG CCATCCGCAC CTAACTCTCC 
0061 ATCCGCAGCA GCAGCACCAC CAGAATCAGC AGCACTTGCA GCATCTGCAA CAGATGCAGC 
0121 AGCTGCACAA CNGCCATGCC CACTCCCGCC CAGCAGGCCG CCCAGGTCCT GGCCATGGAG 
0181 TCCAACGAGC TGCTCATGAG CACCAAGGAC AAGCTCTCTA GCAAGAAGAA AATGCACTTG 
0241 CTCAAGAAGA TCAAGAAGCG CTTTGGATTG GTTCGCCGCT CACCCTCTTC ATGTCCTGGC 
0301 CCCAACAACC TGCCTCCGCT GCAATTCCAC TCCGTACATG GCGACAACAT CCGAATTTCA 
0361 AGGGACGGAA CCCTGGCCCG TCGCTTTGAG AGCTTCTGCA GGGCCATCAC CTTTTCAGCG 
0421 CGTCCGGTTC GCATCAACGA GAGGATCTGC GTGAAGTTTG CTGAGATCTC GAACAACTGG 
0481 AACGGTGGAA TTCGCTTTGG A 
 in silico PCR Fragment
0001 TGGGTCTATC GGATATACCA GCCAACTATA TGCAGGGCAG CCATCCGCAC CTAACTCTCC 
0061 ATCCGCAGCA GCAGCACCAC CAGAATCAGC AGCACTTGCA GCATCTGCAA CAGATGCAGC 
0121 AGCTGCACAA C-GCCATGCC CACTCCCGCC CAGCAGGCCG CCCAGGTCCT GGCCATGGAG 
0181 TCCAACGAGC TGCTCATGAG CACCAAGGAC AAGCTCTCTA GCAAGAAGAA AATGCACTTG 
0241 CTCAAGAAGA TCAAGAAGCG CTTTGGATTG GTTCGCCGCT CACCCTCTTC ATGTCCTGGC 
0301 CCCAACAACC TGCCTCCGCT GCAATTCCAC TCCGTACATG GCGACAACAT CCGAATTTCA 
0361 AGGGACGGAA CCCTGGCCCG TCGCTTTGAG AGCTTCTGCA GGGCCATCAC CTTTTCAGCG 
0421 CGTCCGGTTC GCATCAACGA GAGGATCTGC GTGAAGTTTG CTGAGATCTC GAACAACTGG 
0481 AACGGTGGAA TTCGCTTTGG A 
 Assemble Data

11988R-1.IR_full       1   TGGGTCTATCGGATATACCAGCCAACTATATGCAGGGCAGCCATCCGCACCTAACTCTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     1   TGGGTCTATCGGATATACCAGCCAACTATATGCAGGGCAGCCATCCGCACCTAACTCTCC 60


11988R-1.IR_full       61  ATCCGCAGCAGCAGCACCACCAGAATCAGCAGCACTTGCAGCATCTGCAACAGATGCAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     61  ATCCGCAGCAGCAGCACCACCAGAATCAGCAGCACTTGCAGCATCTGCAACAGATGCAGC 120


11988R-1.IR_full       121 AGCTGCACAACNGCCATGCCCACTCCCGCCCAGCAGGCCGCCCAGGTCCTGGCCATGGAG 180
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     121 AGCTGCACAAC-GCCATGCCCACTCCCGCCCAGCAGGCCGCCCAGGTCCTGGCCATGGAG 180


11988R-1.IR_full       181 TCCAACGAGCTGCTCATGAGCACCAAGGACAAGCTCTCTAGCAAGAAGAAAATGCACTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     181 TCCAACGAGCTGCTCATGAGCACCAAGGACAAGCTCTCTAGCAAGAAGAAAATGCACTTG 240


11988R-1.IR_full       241 CTCAAGAAGATCAAGAAGCGCTTTGGATTGGTTCGCCGCTCACCCTCTTCATGTCCTGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     241 CTCAAGAAGATCAAGAAGCGCTTTGGATTGGTTCGCCGCTCACCCTCTTCATGTCCTGGC 300


11988R-1.IR_full       301 CCCAACAACCTGCCTCCGCTGCAATTCCACTCCGTACATGGCGACAACATCCGAATTTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     301 CCCAACAACCTGCCTCCGCTGCAATTCCACTCCGTACATGGCGACAACATCCGAATTTCA 360


11988R-1.IR_full       361 AGGGACGGAACCCTGGCCCGTCGCTTTGAGAGCTTCTGCAGGGCCATCACCTTTTCAGCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     361 AGGGACGGAACCCTGGCCCGTCGCTTTGAGAGCTTCTGCAGGGCCATCACCTTTTCAGCG 420


11988R-1.IR_full       421 CGTCCGGTTCGCATCAACGAGAGGATCTGCGTGAAGTTTGCTGAGATCTCGAACAACTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11988R-1.in silico     421 CGTCCGGTTCGCATCAACGAGAGGATCTGCGTGAAGTTTGCTGAGATCTCGAACAACTGG 480


11988R-1.IR_full       481 AACGGTGGAATTCGCTTTGGA 501
                           |||||||||||||||||||||
11988R-1.in silico     481 AACGGTGGAATTCGCTTTGGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
100   482  NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 
44.19   213  NM_169256.1  CG11988-RC, transcript variant C (neur), mRNA 
44.19   213  NM_169255.1  CG11988-RD, transcript variant D (neur), mRNA 
0.62   11  40  75  NM_080120.2  CG14560-RA (msopa), mRNA 
0.41   30  NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0.41   16  NM_136870.1  CG13188-RB, transcript variant B (CG13188), mRNA 
0.41   NM_078709.2  CG1417-RE, transcript variant E (slgA), mRNA 
0.41   NM_167751.1  CG1417-RA, transcript variant A (slgA), mRNA 
0.41   NM_167754.1  CG1417-RC, transcript variant C (slgA), mRNA 
0.41   NM_206804.1  CG1417-RG, transcript variant G (slgA), mRNA 
0.41   NM_167752.1  CG1417-RD, transcript variant D (slgA), mRNA 
0.41   NM_167753.1  CG1417-RB, transcript variant B (slgA), mRNA 
0.41   NM_206805.1  CG1417-RF, transcript variant F (slgA), mRNA 
0.41   NM_206803.1  CG1417-RH, transcript variant H (slgA), mRNA 
0.2   28  43  NM_080086.1  CG9930-RA (E5), mRNA 
0.2   34  69  NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0.2   32  47  NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0.2   32  47  NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0.2   32  45  NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0.2   10  30  NM_078663.2  CG5529-RA (B-H1), mRNA 
0.2   37  NM_140717.2  CG13728-RA (CG13728), mRNA 
0.2   17  73  NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0.2   20  75  NM_001038952.1  CG33975-RA (CG33975), mRNA 
0.2   16  NM_080516.1  CG16757-RA (Spn), mRNA 
0   10  106  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   37  81  NM_080259.1  CG14066-RA, transcript variant A (larp), mRNA 
0   37  81  NM_170366.1  CG14066-RB, transcript variant B (larp), mRNA 
0   37  81  NM_170365.1  CG14066-RC, transcript variant C (larp), mRNA 
0   29  182  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.